GenePrediction:GLEAN_1725 Details

Name: GLEAN_1725
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:718945..719848 (+ strand)
Length: 904
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:718945..719016 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_144:719088..719401 (+ strand)
Length: 314
Type: CDS
Source: GLEAN
Position: GCSC_144:719443..719848 (+ strand)
Length: 406
>GLEAN_1725 class=GenePrediction position=GCSC_144:718945..719848 (+ strand)
ATGTCGGCGCCTCCTCCGGCCAGTATGGCTGCTCAAGCGGAAGGCGTGAAGGGCCAACCCAAGATCTACAGGGTGAGTGG
ATGCCCGAGAAGATTGGGAGAGACGGAGAAAGGCAGTGGCAGCTCACCTTCGTCTCCCTGCAGCTTGTCATGACGCCCAT
CATCTTCATATCCTTCCTCTTCTCCCTTGCTTGGGTCGAGTTTCGGTACACGCTGCTCCGCAGCCACACGCATGTCGGCA
TCGACGGACGTCCTACGCGAAGACCGCCAGCACGCCAGCAGCGGCTGCCACCGTGGCTGCATCGCATCGTGTACCGGCAG
CAGGAGTATCAGTACGAGGTTCAAGAGCCTACCGGCGGCGGCGCCACGGCCAACGACAACTTCCACTACCACAGCATGCA
GCGCAAGCTGCTCAAGATGGAGGCGGCCGAGGCGTTCCACATCCGCACGACGGTGCTGTGCGTGTTGGGGCTAGTGCTGG
CCGGCATGACTTGGACAGCGGCACGGCTGGCATGGTGGACAGCCGCGTGGCTGTGGCACTGCGTGACAGGCTGAACAGGC
GTGCGTCTCGGGAGATTACCCGAGCAGACACGAACACCTACATTGGTCGAGACAGTCACCAGGCGTCACCCCAGCAGAGA
GGCCAGACGGACGGCTCACCAGGAGAAGACCAGGATCCTCTAATTAACAAGCAGAGCTTGGCAGACTCTGGCATGCTGGC
ATCGATCCGACAAGAAGTACGGAGTACGCTTGAGATAGAGATTGAGTACGACGCACATCACGTGCAGCGTTTCCTCTCTC
GCTCGTGGCAAATTGTCAGATGCACTATGGCAACGGACACGAAATCCCCCCGACTCCGTCCCGGAAGGGCCGGGCTTACT
TCTGCTCTGGGCCTCCGCTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62