GenePrediction:GLEAN_1726 Details

Name: GLEAN_1726
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:720173..720751 (+ strand)
Length: 579
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:720173..720223 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_144:720288..720462 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_144:720534..720751 (+ strand)
Length: 218
>GLEAN_1726 class=GenePrediction position=GCSC_144:720173..720751 (+ strand)
ATGGCATTCGTACCGACAAACAAGGAGGAGTTGGAGCGGTGGCTGCACAGGGTGAGATGCTGTTGACCGTCCCCGGGGAC
GGTACTTACTGAAAAACTGCCATATGCTTCTGCAGTTCCATAGCGTCAACGATGCCCTCGACACTACGAGGCTGCACGAG
GTCTACGCCAAGGACATCACGCTGCAGTACGGCAACAGGCCACCGGTGCACGGGCTGAACAACCTAATTGCTTTCTTTGA
GCCGACCTACAAGATGCTGGATTCGATGCACCACAAGATTGCATATTTTGGTTGGGCTTCTTTGCTGTGTTGTATGTTGT
TAAATGAGAACGTCTGGGAGTGCTGACGGGTCTGATGACAGATCTCGTTGGCGATGGCAGCCGCTTCTACCAGCCATGCC
ACATCACATACCGCGTGAAGAATGACCCGGAGAAGGAGGCGATCAAGATCCCGGCAATTGGCGTCTGGCATCTGGAGACG
GCGGGCGAGGACGTCGGCAAGGCGAAGCAGTTTGAAGTCTACCTTGACCCGTCGCCTGTAACGGCTGCTGTGGCCAGGGC
GACGGGCCAGGCGATTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62