GenePrediction:GLEAN_1728 Details

Name: GLEAN_1728
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:726509..728830 (+ strand)
Length: 2322
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:726509..726639 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_144:726702..726806 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_144:726868..728830 (+ strand)
Length: 1963
>GLEAN_1728 class=GenePrediction position=GCSC_144:726509..728830 (+ strand)
ATGACTTCCACTACCAACGAGTTCCGAGCCCTCAACGAGGGCATCCAGGCAGGGCTTATTCAAAAGCTCGAAGTCCACGT
CGCGGCGAGCGCAAGCACAGGCACGACTGTCGTTCCGGGCTCTATGCTTCGGTTCCCAACCCGCTAACAGTCTCAGAAAA
ACCACCAAGGCCGGTTCTGTCGATACCATTTAGCCGCAACCCCGACTTTGTTGACCGCGGGGATACACTGGGCAGAATCG
AGGATATATGTTCCAAGCCGGCTGCTCGCGTGGCCCTCGTGGGTCTCGGCGGTATCGGGTAGGCGCCATATGTCTCGATG
AGTTTTCAGCTGCTGTTGGGGCTGAGCTGACGTGCTTAGAAAATCGCACATTGCTATCGAATATGCGCATCGTCTTGCAC
TCGATGACATAACGCGATGGATCTTCTGGGTCCATGCCGCCACACAGGCGCGCGTAATCGAAGATTTTAATGCGATTGCA
AACGTTGTCAGATTACCAGGACGGGAGGACCTCACAGTAAACGTACTACAGCTTGTCCTCAATTGGCTTTCTGATGAGCG
AAATGGAAGATGGACCTTGATCCTTGACAGTGCCGACGATAGAGATGTGTTTTTCAGCTCGGACAAGGGAACAAAGGAGG
GAAAACAGCTTCACACCTACATACCCCAGAGCCGCAACGGCAACATCATCATCACGACCCGGGACAAGGACTTGGCCAGA
CGTATGACCGGCAGACATCAAAACGTCCTCGACATAAACCCGATGACAGAAGTAGAGGCTTGTTCGCTCCTGAGAAACGA
AACGAGTTACCTCTCAGAGAGGGACGCGGATGCGGAATTGGAGCTGGTGAATGCTCTTGACCTTGTTCCACTCGCAATAA
GCCAAGCAGGCGCATTTATACAAGAACGAATGCCCAGAATGTCAATCGAAAAGTATCTGCGTGACTTTCGAGAAAGCGAA
CCCAAGAGGGTCAAGTTGTTGCAGTTTGACCAGGGTGATCTTCAGAGGGACGGAAGCGCGTCGAATGCCATCCTTACAAC
CTGGCTGACGTCTTTCGAACATATTAAAACAAAACGGCCTTCCGCAGCAGATCTGCTCTCGCTTATGTGCTTTTTTGATC
GGCAAGGGATCCCAGAGTCTGTCCTCAGGATACAAAAGGCGAGAAAGGAGGAAGACCAAGCAGGACAGACAGGAGAACAG
AGCGGCCCAGGACCTCGCGGAGGCCTGGATGACACCTTCGAGGACGATATCCATATGCTGAGAAACTTCAGCCTTGTGAC
CACTGACAGCAGCGGACATGCATTTGAAATGCATAGACTTGTGCAATTATCGACCAAGAGGTGGCTGAGCACACACAAAG
AAGACGAGAAGTTCAAACAACAGTTTGTATCAAGGATGGCGGCGGTGTTCCCAGACCCAGAGTACGAGAAATGGGAAACA
TGCCGAGTGTTGTTTCCGCATGCTATTCTGGCACTTGAATACGAGCCGGCTAAAGGCGATGTGCAAGAGATGTGGGAACT
GCTATTGCGAAATTGCGGAGAATACGCCACAGATCAAGGCAGATTCCTCGTGGCAGAACAAATGCTTCGCGAAGCTCAAA
GGACTTCAGAGGCTCGACGAGGAAATGATGACCCTGCAACCACGCATATTACTCGTTTGCGAGCTGTCAACATCTTTGAA
ATGGGAGATTGGGCAGAAGCAGAAACGCTACTGGTGCAGGTCTTAAAGACTGAGAAGGCTGTGCTTGGGACCGACCACCC
TGACACACTGGCTAGCATGAACAGCCTAGCATTAACGTATTACAGGCAAGGTCGGTTAGCAGAGGCGGAAGAGCTGCATG
TGCAGGCCTTAGAGAAGACAAAGGCCGTGCTTGGGACCGACCACCCTGACACGCTAAAGATCATGAACAACCTAGCATTG
ACTTATCTTCAGCAAGGTCAGTGGGTAGAGGCGGAAGAGCTACAGGAGCAGGTCTTAGAGAAGAGGAAGGCCGTGCTTGG
GACCGACCACCCTGACACGCTAAAGATCATGAACAACCTAGCATTGACTTATTATCAGCAAGGTCGGTGGGTAGAGGCGG
AAGAGCTACAGGAGCAGGTCTTAAAGAAGAGGAATGCTGTGCTTGGGGCCGACCACCCTGACACGCTAAGTAGCATGAAC
AACCTCGCTACTACATGGGGAAAACAAGGGCGGCGCGCGGATGCGGTTGGATTGCGAAAGAGCTGTGTTGAGTCGGCGCG
ACGCGTCCTTGGAGCCGATCATCGACGGACAAAACGCTATGAACGATATTTAGAAGCTATTGGCCTTGATGCGGACGACT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62