GenePrediction:GLEAN_1729 Details

Name: GLEAN_1729
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:734604..736410 (+ strand)
Length: 1807
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:734604..735644 (+ strand)
Length: 1041
Type: CDS
Source: GLEAN
Position: GCSC_144:735697..736410 (+ strand)
Length: 714
>GLEAN_1729 class=GenePrediction position=GCSC_144:734604..736410 (+ strand)
ATGGAACAAAGGATTGTGCTACCGGATCTGTCCTTGGACATCGACTCTGTGGTGCGCCGGCTTCTTACTGCAATCGCAGC
CGTTGCGGTCGCTTTGTATCTTCTATACCAATGGCTTTTGCCAAAGCCTATTCCTGGTATCGCATACAATTTGGAGGCAA
CACAATCTTTGCTTGGTGACGCCCCGAGCATGGTGAAAGAAGTCAGAGTCACGGGCGAGTTTCGTGTCTGGTGCGCAAAG
CAGATGACGAAGTTAAACTCGCCTATATGCCAAATTTTCATTCGGCCGTTTTCAAAGCCCTGGATCCTACTTGCGGACTT
TCGTGAGTCCAAGGATATCTTGATGCGCCGCAAGGAGTTCGACAAATCGTCTTTTTTATCGGATGGAATGGCATGCATGG
GCGCATTCCATGGAATATACAAGACGGGCGACAAATTCAAGGTCAACCGACAGCTTATCCAGGACCTTATGACTTCAAGC
TTTCTAAATAATCAGGTGGGACCGGCAATATACAGAAAGGGCGCTGAGCTTGTAAGGTTGACAGAGATGAAAATGGACTT
GGCAAATGGAAGACCATTTAGCGCCAAGAAGGACTTCGAGTATGCGTCACTGGATGTCATGCTGGAGTTTGCATTTGGCA
GGAACTGGACTGATACATCACTGGGACAACAAACCGAGCTGATCGGCAGGCTAAGCGCTTTCGACGTGAAAGCCGGAACT
GTAGATGAGCCAGTCCGATTTCCGTTGAGCCCCATTGCCGACTTTCTCAAATCTGTATACGAGGCCCCGGAAATTGTGGA
GAGGACGATCAACGCTCTGATGCCGAAGCTACAGACATGGTGGTGGTCTAAGCAGGCATGGTACAAAAAGATATTTGAAG
ACAAAGACCGGGCAATGAAGGAGCAGGTTTCCATTGGCGTAAAGAACGTTCAAGCCGGCCGGATTGAAACGGGCGTTGAG
CACATGCTGATGCGCGAGGCCTCTCGGGCTGCGAAGGAGGGCCGTGAGCCTGATTTTAACAGCGCTATCTTCCGTGACGA
GGTTAGTGACCACGCAGGTATCGAAAATGGTAGACTGAACGCTGATTTCCTAGTTGTTTGGCGATATCGTCGGTGGCCAC
CACACAACGAGTGGAGGAATGATGTGGTTGGCCAAGTATCTTAGCGACTTGCCTCTTGTACAGGTGAAGCTGCGCTCAAC
ACTGTACGATGCTTTGGCCGTGGCAAAATCAGAGAATCGCTTTTTCACGTTTGAAGAAATAAGGCAGGCACGGCTGCCTT
ATCTGGATGCTGTGGTCGAGGAGATGCTGCGTATCAACGCTGTCCCCGTAACCCGAGAGGCCTTGTGCGACACAACGGTG
CTCGGATACCCGATCAAAAAAGGAACGCAGATTTTCTTCATGTCGAATGGGCCAGGGTTCCTGTCGCCGTCTCTAGCAGT
CGACGATGGGCGGCGGAGTGAGACGTCGCGATCAGCCAAGCTAAATGCCAAGTGGGACGAGTCGCAGAATCTGGCCGTTT
TTGAACCGGAGCGCTGGCTCATTCGAAAGAAAGCGGGGACCGGCGTTTCTCCAGATGAGGTAGACTTTAATGGAGCTGCA
GGTCCCCAGCTGGTATTCGGACTGGGACAGCGCTCCTGTTGGGGTCGGCGGCTGGCGAATATGGAAATGAGGATCATTAC
AGCTATGCTCGTGTGGAAGTTTGAGCTGCAAAAGGCTCCCGAGTCACTATCTACGTATGCTGGGATAGAAGGCATTGCCC
GGGTTCCACAACAGTGTTACCTTCGCGTTAAGAAGGTCGAGTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62