GenePrediction:GLEAN_172 Details

Name: GLEAN_172
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1148738..1150283 (+ strand)
Length: 1546
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1148738..1149782 (+ strand)
Length: 1045
Type: CDS
Source: GLEAN
Position: GCSC_179:1149856..1150283 (+ strand)
Length: 428
>GLEAN_172 class=GenePrediction position=GCSC_179:1148738..1150283 (+ strand)
ATGGCTACCACTACTTCCTCCAGCCTGCAGGCTGCTAAGAACCCTGCCCTTCGGCGGACGATGAATGCGGCCACAGGAGA
CCCGGACGCCTCTTCTCCTTCAACTGCCGCCCAGTCACCGGCCGACTCGCCCCGACCGTCGGCTTCTTCGACCTCTCTCT
CGTCTCTCTCGTCCATGGACGAGATCGCCAACACCAAGGTGTCGTATGGCAAGTTGCTCGACACATATGGAAATGAATTC
GAGGTGCCCAGCTTCACCATCAAGGACATTCGTGATGCCATCCCCAAGCACTGCTTCAACCGTTCGGGCCTCCGAGGAAT
GGCCTATGTTTTCCGCGACCTGTTGTACCTCTCCATCACCTTCTACCTTTTCCACAACTTCAACACTCCGGAGTATGTCC
CGTCTGTCATCGTTCGTGGTGCTTTGTGGGCCATTTATGGTTTTCTCCAGGGCCTTTTCGGTACCGGCATCTGGGTTCTA
GCCCACGAGTGTGGCCACGGCGCCTTCTCCCCGTCAAAGATGTTCAACGACACTGTGGGCTGGGTCCTCCACTCCTCCCT
GCTCGTCCCCTACTTCAGCTGGCAGCTGTCCCATAGCAAACACCACAAGGCAACCGGCAACATGGAGCGCGACATGGTTT
TCCTGCCCCGAACCCGTGCGGACCATGCCACACGGCTTGGACGCCTTGTTCACGAGCTGTCGGAACTCACCGAGGAAACC
CCAATTTATACCTTGATGATGCTCGTGCTGCAGCAGCTCGTTGGTTGGCCGAACTACCTCATCACAAACGTCACTGGCCA
TAACTATCATGAGCGCCAACGTGAGGGCCGGGGCAAGGGAAAGAAAAACGGGTTATTCACCGGAGTAAACCATTTTAATC
CGAATAGCCCGCTTTATGAGAACCGAGATGCCGGCCTGATTGTTCTGAGTGACATTGGCGTGGCGCTGACTATGACTGGT
CTCGTCTATCTCTGCCGCACATTTGGCACTGCAAACATGATGGTTTGGTACTTTTTGCCTTATCTATGGGTCAATCATTG
GCTAGGTTAGTGCACTGAAATTGGCTTGGTCAGACGAGATCTGGCGAGAGAACCAGCTAACAACCCTTTCACACATAGTG
GCTATCACCTTTCTCCAGCACACCGACCCCTCTCTGCCTCATTATACCCCGGATGCGTGGAACTTTGTTCGTGGCGCGGC
AGCGACCATCGATCGTGAATTTGGCTTTATCGGGCGTCACCTCCTGCATGGTATCATCGAGACCCACGTTCTTCATCACT
ACGTCAGCACCATCCCGTTTTATGAGGCCGACGAGGCCACGGAGGCGATCAAGCCGGTCATGGGGAAGCACTATCGCTCC
GACGTTAAGGACGGCTCGTGGGGCTTCATCAGGGCTATGTACACAAGTGCGCGGATGTGCCAATGGGTAGAGCCTAGCGC
CGAAGCCACAGAGCAGGGCCAGGGTGTGCTCTTTTTTCGCAATCGCAACGGGCTGGGTGTCAAGCCGATGAAGCTTGAGC
CGGTCGCCGAAACCGCTGCGTTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62