GenePrediction:GLEAN_1730 Details

Name: GLEAN_1730
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:739551..747824 (+ strand)
Length: 8274
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:739551..739680 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_144:739928..739960 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_144:740029..740500 (+ strand)
Length: 472
Type: CDS
Source: GLEAN
Position: GCSC_144:740567..747824 (+ strand)
Length: 7258
>GLEAN_1730 class=GenePrediction position=GCSC_144:739551..747824 (+ strand)
ATGGTCCGTGCACCGTCGCGCAAGAGCGAGATGGCCAATTCGGCCGACGGGTCGGTCTTTGTGGCAGGAAGCCGAGACCG
TGCAGCAGAGCGCCGTACTGATGTTGTGGCGCTGGCAGACAGTGTTCAAAGTAGGTAATCAGATAGGCGAGAAATGGAGC
CTCAGGCTATGGTTATCATGGTGGCATTACAGAACGTAGGATATCACGATTGAGCTTGGGCGTGTGTTTATAAGGCTTTG
AATAGATCGAAGAGTTGGCTTTCTAAGACACTTTGATATCAATTCAACATTGCGTCTCATATTCGCAACTAAAATTACGG
AGCAAAAATACAGTTTACAGACAGGGCCTAACAACGTATCTACGATGAGCAAAGCAGATGAACACGAACCGGTGGCGATT
GTAGGAATGGGTACGTCGGATGGGTTGTGAAGTTTATGCGATGTTGTGTGTTTTGAGGACCAAGCTGACTATGTGTAGGA
TGCCGGTGGCCCGGAGGGGTCGAGAGTCCGGCGCAGTTCTGGGAGTTTCTGTGCAACAAGGAAGACGGATGGCGTGAGTT
CTCAGCGCCAAGATTCTCAGCCAAGGGCTTTTACCACCCAAATGCGGACCGGCCGGGTGGATTCTCGATGAAGGGGGCGT
TTCCCACCGGCGGCGACGCGCGGTTGTTCGACCATGCCTTCTTTGGAATGACGAAGCTGGAGGTAGAGACGATGGACCCA
TCGCAGCGGAAGCTGCTGGAGGTCGCGTACGAGGCGATTGAGAGTGCGGGCGAGACATGGGAGAGCATCTCGGGGACGCG
GACTGGAGTGTTTGTAGGCAACTTCTGCCTGGACCACTGGATGATTCAGTCGCGGGACTGGGATAACCCACGACCGTACG
CATTTGTGGGAGCGGGCACGAGCATCCTCGCGAACCGGATCAGCTACATTTTCAACCTGCAAGGGCCAAGGTATGTCTGC
CGGGAAATGAGAGATATGAGGTGGAAGTGGCGAGCTGCAAAGCTAACGCGAGATAGTCTCACGATCGACACGGCGTGCTC
GTCATCGATGTACGCGCTGCACGTGGCAGTGAACGCGATGCGGGCAGGCGACTGCGACTCTGCGATTGTGGCATCGGCGA
ACTGGATTGCCGATCCGGGGGTGCAGATTGCGCTGGACAAGCTGGGAGCGCTGTCGGGGTCTTCGCGGTGCCACACGTTT
GACGCGCGGGCGGACGGGTATGCGCGCGGCGAAGGATTCGGGGCGATCTATCTGAAGACGACGGCACGAGCGATGGCAGA
CAGATCGCCGATCCGGGCGATGATCCGGGGCTCAGCGATGAACTCGAACGGACGAACAGGCGGGATCACGCGACCGAGCG
CAGCGGGCCAAGAGGCAGTGATCCGGGCGGCATACGAGAACGCAGGACTGGAGCCGGACGAGACAGGCTACTTTGAGTGT
CACGGCACGGGAACGTATGTGGGTGACCCGATCGAGGTGGCGGCAGTGGGCCGGGTGTTTGGGTCGATGGGTGTGGCGAA
AGCGGCGCCACTGCTGGTGGGCTCGGTCAAGAGCAACGTGGGACACGGCGAGGGTGCGAGCGCGCTGGCGGCAATCATGA
AGGTGGTCCTGGTGTTGGAGCATGGCGTGATTCCACCGGTATTCGACCTGGCAACGCGCAATCCGAACATTGATTTTGTG
GGGGCAGGCGTGCAGCCGGTGACGGAGGTGACGGCGTGGCCAGCTGGGCAGCTGCGACGGGCGAGCATCAACTCGTTTGG
CTACGGCGGCGCGAACGCGCACTGCATCGTGGATCACGTAAACAACGTGTTGGCAGACTACGTGGCGCCGGGTGTGTTTG
GGCGCGATGGGCGGGGCGATGACGCATGTCGGGCGCTGCGGGCGTCGACGACGGCGACGACGCGGCAGCTGGTGCTTCTA
GCGCTGTCGGCGCACAACGAGCAGTCGCTGCAGAGCAACATGGAGGCGTTGGTGGCGGTGGTGGGAGGGCTGTCGCTGGC
GGACGTGGCGTACACGTTCAACGTGCGGCGATCGCGGCTGGCGCAGCGGACATTTTGCGTGGTGGAGCGGGACGGGCCGA
CAGTGGGTCTCCAGACAGCGCTAGCCGCACTCCGGGCCGGGGGCAAGCCGGTGCGGGCGCCACGGCAGCCGACGCGGCTC
GGGTTCGTATTTACGGGCCAGGGAGCACAGTGGCATGGAATGGCAGCAGGCCTGTCTGAGCACGCCGTGTTCCGACGCAC
GGTGGCGCACCTGGACGCGATCCTGAAACGACTACCGCAACCGCCCAAGTGGACGCTGGCGGCCGTGCTGGCAGGCGACT
GCGATGAGACGCTGGTGCAGACGGCAGCCGTGGCACAGGCAGCGTGCACGGCACTGCAGATCGGACTCGTGGACCTGCTG
GCGTCGTGGTCGGTGCAGCCGGCAGCCGTGGTCGGGCACTCGTCAGGCGAGATGGCGGCGGCATACGCGGCCGGTCGGGT
CTCAGCGGCTGAAGCGATTGTGGCGGCCTATATGCGCGGCCAAGCAGTTTCGGAGAACCGGCAAAGTGGCATGATGTTGG
CTGTTGGCTTAGGGCCAGAGGCAACGAAACCATACCTCGACCAGGTGCCGGAGGGCAGCGTGCAGGTGGCGGCCATCAAC
GGGCCCGGCAACGTGACGCTCTCGGGCGACACAGAAGCCATCGAGACAGTGGCAACAGCGCTGGCAGCAGACGGCATCTT
CCAGCGACGGCTACAGACCGGCGGCAACGCGTACCACTCGCACCACATGCGGACGATCGGGCAGACGTACGCGGCGCTGC
TGGCGACGGGCGACAAGCTTCTATGCGAAAGCAAGACCGCAGCGCGGTCTGGTGATCAGCAGGCAGTCTGGTTCTCGTCC
GTGACACCAGAAAGGGCAACAGAGACGATTGGTGACTTCTCGGCGTACTGGCGGTCCAACCTGGAGTCGCCGGTGCAGTT
TGCCGAGGCGGCACAGCGCATGGTGACGGACACGGTCGACGTCCTGGTTGAAATCGGGCCGCATCCAGCGATGAAGAGTC
CTGTGGGCCAGATCCTGCAGACGGCCGGACGTACGATGCCATATGCGGGCACGCTGCGACGCGGTGAGGCTGGTCTGCGG
TCGCTGCTCCAGCTGGCAGGCACACTGTTTACGCTCAACACAGCGATCGACCTGGCTGCCGTGAATGCGGTGGATGTGGA
CGATGGTCGGGTGCACGGCTGCACGAGCACAGAGCTGCCGCCGTACCGCTACACATACACGGGCCCCAACTACCACGAGA
GCCGGGCCAGCCGCGAGTACCGGATGCGGCCAACGCTGCGTCACGACCTCTTGGGATCCCAGGTCGTCGGCACGGCCCTG
CTGCGGCCACAGTGGCGCAACATCCTGCGGCTCCGGGACTTGCCCTGGCTCGGCGACCATCGACTTCTGCCGGATGCCGT
GCTTCCTGGTGCTGGCTACGTGGCGCTGGCACTGGAGGCTGCCGCGCGGATGGCGACGAGCTCGACCATTGCCGGCTTCT
CGCTGCGTGACGTGGCCATTTCCGCGAGCCTGGTGCTGCCCGAAGACGACTACGGTGTCGAGATCCTGACGACGCTGGAG
CTGGCAGGCCCGGTCTCCGACACTACCACGACGTGGGCGACGTTCTCGGTCAGCTCGGTGCGGCGTGACACGGACATCTG
GACGGAGCACTGCACCGGCAGCGTGCGGGTCGAAACAGCAGCAGCAGACGAGACGAGTCTGGACGACATGGCCGCGAGCA
ACAGCGCGACAAAACCCGTCAGCGCGGCCGCTTGGTACGAGCGCTTTGAGGAGCTGGGCCTCGGCTACGGGCCGACTTTT
CGGTCGCTGTCGGCACTGCGCGTGGATGCTGCAACGGGTGTGGCGATGGCGGATCTGAACCTGGAGCCGGTCGAGCAGCC
GGACGAGTCGAGCTATGCCGTGCATCCAGCAGCGCTGGACGGTGCCATCCAGCTCGGCTTGGTGGCTGCACATGGCGGTC
GCACGGCTGCGGCCGACACAGCGCTGGTGCCTGTGTGGCTGGCACGCGCATACGTGTCGACTGGGACTTCTGGGTCTGGA
ACTGGGTCGGTTTTTGCTCAAGGCGCCCGGAACGGCGTCCGCAGTGCGGAGCTGCGTCTTTTGTTGCGCCGTGCCGATGG
CAGCATGCTGATGCGTGTGGATGGGCTGCGCTGTGTGAGTTACGCGCGACCGGCAGCCAAAGCCGATCCGGCAGCTGCTT
TTGCCAGCCCGTTTACGAGGCTCGTGTGGCAGCCAGACGTGCGAACACTCGGGATAGACCAGGCACGCAAGCTGTGGCCG
CCACCGGCTGCCAATGTCGACCAGGCGGCCGTCTGGGGCGTGACCAACAAGCTAGCGCACTTGGTCGTTCTCTCGCTGGC
CGAGCAGTTTGTCGACGTCAAGCTCGACCTCCAACTCGACGGCGAGCGCAGCCACTTTCTCGCCTGGATCCAGCGCCGCG
CCCGCACCGATCGCTCGCCGCTGATGGCAGAGGCACGTCAATGTGCTGCCCAAGGCCGGCTACGCGAAGCCATGGACGAG
CTCGCAGCCGCGGCACCGCATGTGCGCGAAGTACAGAGTGCACTGCTGCTGCACGACAGCATGGACGAGATCCTGCGCGG
GCGCCGGTCCGGCGTCGACGTGCTCGTGGCCGCCGACCTGCTGACGCCGCTCTATGCGGAGGGCCTGCTCATGACCGGCA
TCTACCCACAGCTGCGCCGACTGTTGGCGAGTCTCGCGCATGCTCACCCGAATCGTCGCGTGCTCGAGATCGGTGGTGGC
ACTGGTGGCGCCACGCGCGTCGCCATGCAGGCGTTTGGTGCCACCGGCGGCATCAAGGCCTACCACGACTATACCTTTAC
CGATATCTCGGCTGGTTTCCTCGCCGCGGCGCGCACGTCGTTTGTCGCCTGTCGCGACATGCACTTTGCCGTCTTTGATG
TAGAGACCCCTCCGGCTGACCAGGGCTTCGATGAGGGCCAATACGACCTCGTCCTTGCTTGTCAGGTCCTCCATGCCACT
GCGGACATGCATCGAACTCTCACGCACTGCCGACGCCTCCTGCGCCCCGGCGGACAGCTCGTGCTCGTCGAGACCATCGC
CAACTTTATCGTGCCTGGCGTCGTTGTCGGCACCTTTACCGGCTACTGGGCCGGCATTCCCGATGGTCGCGTCGACGCTC
CTTTCCAAGATCTTGCTGCCTGGGACAGCGCTCTCCGGGCTGCCGGTTTCTCTGGCCTCGATATTGTCCTGGACGACTTT
CCGGAACCACACAGGACTACGGCCGTGATCTTGTCCACCGTCGAGGTTGTGGCTGAGAATGTGGCTGTGGCTGAGAATGT
GGCTGAGGCTCCCGCGTCTGTCCAACTCTTCTACAGTAGCGAGGTAGTGCCAATGCTCGTCGCACCCCTTGTCGATGCTC
TCGCTGACAAAGGTGCTACCGTTGCTGTCGCACCTCTTGCCGACGCACTCGCTGACAAAGGTGCCACCCTCCGCGCCGTC
GTTCTCCTCGACGACTCTGCCCTTCGTCGACTGGCAGACAGCAACGACCCATCCGACCTCCTGGTCTGGCAGCACCTCGC
CCGCACCGCCTCGAGCCTCGTTGTCCTCACCAGCTGCGGCACTGCCCGTGGCCGCAACCCCGACGGTGCTCTTTTGGCCG
GTCTGTTGCGCGTGCTGCAGACAGAAAACCCAACGGCAGAGTATCTGTGTGTGGATGTGGACGCAGTCGAGTTTGATGTC
GGTGCCGCTGCTCTCGACCTGGCCCGCGTCCTGGCTGCGCACGAGGCCCGTCTCCAGAACCCAGGCGCAGACGACCGCGA
GTTCGTCTGGCAGGACGGCTGCCTCTGGGTCAGCCGCTACGTACCTGACGGCGGCTTCCACGGCGAGCAGGCTAGCCGTG
CCCCACCTCCCGTCTTCGGCCCGATCGGCTCTGTCGCTACCACCGGCCCGCGTCGCGCCACCTTGGCCACGCCCGGCTTG
GTCGCCTCGCTGTCTTTTGCCCCCTACGACGACGCTCTCCGTCCACCTCTGCGCCCCGGCCAGATCACCGTCGCCGTCGC
CGCTGCCGGTCTTGGTCCCCGCGACCTCGACCGCTGGACTGGCCGCGCCGACAGCCACTTTCTCTCGTGCGAGTATGCCG
GCACCGTCCTCGCCCTCGCGCCTGACGTCGTCACCAATCGCCCCGATCTGTCTGTCGGCTGCCTCGTCTACGGCCTCGGC
CTCGCCCACTTTGGCACTGCTGCCCGCGTTCCCGCCGCTCTCGCCCGTCCTCTCCCCCCAACCGCCGACCTGCTCTCTGC
TGCGGCTCTGGCTTTTTCCGCCACTACCGCTGTCTACGCCCTCGATCATGTCGCTCGCCTTCGTCGTCACCATGCCGTCC
TCGTCCAGTCGGCCACCCACGACGCCGGTCCGGCTCTCGTCCGTCTCGCTGTCGCTCGTGGCGCCCTCGTCTTCGCCACC
GTCCACACCGACCAGCAGGCTCGCTACGTCTCCGAACAGCTGCATCTCCCGCTCGAACACATCGCCATCTCCTCGCCTTC
GGCCCTTCACCAACTCGCCCAGCTCACTCCCAAGTGCGCCTTTGACGTCATCGTCCACTCCACTGGCACCACAGCCACAA
CGGCTGCCGTGCGTAACAGCCTCCTCGACACCCTGCAGGTTCTCGCCCCCCTCGGTCACCTCGTCGACCTTAGCCGCGCC
GATGCGCCAGTTACCTCTATCTCGACCATAGGCCCCGAGCTGCTGCCGCGTCATGCCTCTTACTCTGCCGTCGATCTGCT
CTTCCTCCTGCGTGAGCATCCCGACCATGCCGCCAACCTTTTGGCTATGGCCCACGACGCTTTTCGCGCAGATCTTCTCG
TTCCTGCTCCGGCCGTCACCATCGTCCCGGTGTCTCAGTGCGCCGTCGCCGCCACTACCCTCGCCAGCGCCACAGACGCC
CCTGTCGGCCGTCTCGTCGTTCACTTCCATCCCACTGATATCGTGCGTCTCGTGCCTACCGCACCAGCAGCTCGCTTCGA
CCCCAATGCCGCCTACATTGTTACCGGCGGTCTTGGCGGCCTTGGTCAGACTCTTGTCCGCTGGATGGCTTCTGCTGGCG
CTCGCCACATTACTGTCCTTGCCCGTCGCGACCCCATCGCCGTGCCCGGTGCCTCTGCTCTCCTCTCTGACTGCACTGCC
GCTGGTGTCGACATCCTCTGGCAGGCTTGCGATGTCGCCGACGCTGCTCAGGTAGCCCACGCTGTGAGCATCGTCACTGC
CCAACGTCCCCTCCGTGGCCTTGTTCATGCTGCCGTCTCCTACTGCGACTACTCGTTTGACGGCCTGTCTGTCCACACCT
GGCAAGCCGGCCTCGCTGCCAAGGTCGCTGGCACACGCATCTTGCATGATGCCACCCGCCATCTTCCGCTTGACTTCTTC
GTCATGACCACGTCCGCTCTTTCCCTCTACGGCTTCGCCACCCAGGCCGCCTATACGGCTGCCAACCGCTTCCAGGATGC
CTTTGCCCGCTACCGCCGCGGTCTCGGCCTGCCTGCCTCTGCCGTCTCGCTTGGCCTCGTCGCCGAGCTCACCACCGTCG
GCTCCACCGATCGCACCATTCATCTCTTTGCCCGCAACCAGGCCCAGACTCACGGCCCCGACGACATCATCGCCCTGCTC
GAGCCTGCTTTTCTCGGCAATCAGACTGCCCACTCGGCTGCCTCAGACCAGTGGCGCGGCCAAGACGACGACCCACTCTC
GGCCGCCAATCTGCACGCGTACCTCGACCCCCACAAGCTTGCTGCTGCTACTGCCACGGCTACTGCGCCTTCCTGGCACG
CTGATGGCCGCGTTGCCCTCATGCTGCGTGCCTTGCGTGATGCCCGTTCTGCCGAGGCGAGCGCCACAGCTGCCGCACAC
AGCCCTGAGGGCCCTGCTGTGGCCCACGCACCTGCCCTCGTGCGCAACCAGCTCGATGCTGCTGTGTGTGCCGGACCCGA
TGGCCGTGCCGGTGTGCTCTCGCTCGTGCAGACGGCAATTTCTACCGCCGTCGCCGCCATGCTCTTCGTCGACCCTGACG
GCGTCGATCCCACCCGCTCCGTCGCCGACCTTGGCGTCGACAGCCTTATCGCTGCTGAGCTGCGCACATGGTTCCTACAG
GCCCTTGCCACTAGCATTAGCATGCTGGATCTCTTGGATCCCGCTGTCAGCATTGCCGCACGCGCCGCTGCCATCACAGA
CGCCGCACTGCAGCCCCAGTCGGCGACAGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62