GenePrediction:GLEAN_1731 Details

Name: GLEAN_1731
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:749994..750954 (+ strand)
Length: 961
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:749994..750301 (+ strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_144:750355..750462 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_144:750527..750683 (+ strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_144:750763..750954 (+ strand)
Length: 192
>GLEAN_1731 class=GenePrediction position=GCSC_144:749994..750954 (+ strand)
ATGGCCTCCTTCCTCGTCACAGGAGCTTCTCGCGGCCTGGGCCTCGCCCTCACCAAGGAGCTCGTCTCCCTGCCAGCTGC
CCAGGTCAGTATGATCTTTGCCTGCGCCCGCGGTGACGCCCCTCCTCTACACGATATCGCCAAGGCGTCCCACGGCCGCG
TCGTTGTCATCAAGCTAGATGTCACCGACCAGGCCTCCATCAAGACGGCTGCTTCCCAGGTCGAGACTGCTCTAGGCGGC
AAGGGCCTGGACGTGCTGATCAACAACGCCGGTGTCTGCCAATACGCCTTCAACGGTATCACGTCCATGTAGGCCGTATC
CGCTGCTCTGTTTCTTTTGCCAGCAACGCTAATCGATGTAGGGACAACCTCGAGGAGAGCTTTGGCATAAACGTTCTGGG
CGTTCACTGGGTCACCCGCACCTTTCTTCCCCTTCTGCAGAAGGGTACGCTCAAGAAGGTCATCAACATGTAAGCGCTAC
GCACTGCCGTCAGTCCTGTCTTACTGCTGCAATGTCCAGCTAATCCCTCATAGCTCCACGACCATCGGCTCTATCGCCCT
CGCCCGCGACGCCGCCCTCCTCCCCGCCCCCTCCTACAAGATCTCCAAGGCTGCCCTGAACGCCCTGACCGTCCAGTATG
CCCTTGAGTATGAAAAGGAGGGATTCACCTTCGCGGCTCTCTGTCCTGGGGTACGTACTTGGAAAGAAGAAAGAACTGCG
GATAGGTCAGAGTTCACCTGAAGACTGCTGCTAACTGTACCAACTATAGTGGCTCAAGACTGAGCTCGGTGGTGGCGACA
TGGCCGATCTTACTCCCGAGCAGGGCGCCAAGGCCTCGATCGATATCATCTTCAATAAGACCCAGGCTGAGATCAACGGC
CAGCTGCCCAAGGTCTTCGTCAAGGGGTGGGAGAAGCCCGGTGGCCGCAACGTCTACGACGGCACGAACGCCCCGTGGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62