GenePrediction:GLEAN_173 Details

Name: GLEAN_173
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1155107..1156813 (+ strand)
Length: 1707
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1155107..1155109 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_179:1155175..1155329 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_179:1155430..1156813 (+ strand)
Length: 1384
>GLEAN_173 class=GenePrediction position=GCSC_179:1155107..1156813 (+ strand)
ATGGTGAGTACTACGGGCTTGGGCCATTAGCTTACTGTGACTTAATATATTTTTAACGATCTGTACAGGCTTCATTCAGC
CCGACTCAGATTTTCGACGAGGGGACGACTGAAGAGAAAGGAGAAAATGCACGGCTTTCTGCCTTTGTAGGCGCCATCGC
TGTTGGCGATCTGGTCAAAAGCACTCTTGGGCCCAAGGGGATGGACAAAATTCTGCAGTCGGCGTATGTGTACCTCAGCA
CTGGGATTTGGGGGATTTCTTGCCGAGCTGATGGGCCTGACTTTCGTTTGACGTCGTTGCACAAGCTGACTGCATATCTA
CAGATCTACCGGAGATATTATTGTCACGAACGATGGAGCTACGATATTGAAGTCGATCGCTCTTGACAATGCGGCCGCAA
AAGTGCTCGTGAATATCTCTAAAGTCCAGGACGACGAGGTTGGCGACGGCACGACGTCGGTTGCTGTGCTCGCAGCCGAG
CTTCTACGCGAAGCGGAGAAACTAGTGGACAAGAAGATCCACCCCCAAACCATCATTGAGGGTTACAGGATAGCCAGCCA
GGCGGCGCTGCACGCGCTGGAGCAGTCTACCGTTGATCACAGCAAGAACCCGGAACTTTTTAGGAAAGATCTTGTCGCCA
TCGCAAGAACTACACTCAGCTCCAAGGTGCTCGCACAAGACCGGGACCATTTTGCCGAACTTGCCTGTGATGCCATTTTG
CGTCTTGGCGGCTCGGTTGACTTGAGTCATATCCAGATCATTAAAAAAACAGGCGGCAAACTCGGGGAATCCTACCTCGA
TGAAGGCTTTATTCTTGACAAGAAGATCGGCGTGAACCAACCAAAGCGACTTGAGAAAGCGAAAATTCTTATTGCCAACA
CTCCTATGGACACGGACAAGGTGAAGATTTTCGGTGCTCGGGTCAAGGTCGGCTCGACAAGCAAGCTGGCCGAACTTGAG
AAGGCCGAAAGAGAAAAGATGAAAGCGAAAGTGGAGAAGATCAAGGCTCACGGGATAAACTGCTTTATTAACAGGCAGCT
GATCTACAACTGGCCTGAGCAGCTCTTCGCGGACGCTGGCATCGTCTCCATTGAGCATGCAGACTTTGACGGCATTGAGC
GCCTGGCACTTGTCACGGGCGGTGAAATAGCGTCGACATTCGATCACCCAGAGCTGGTCAAACTGGGCCAGTGCGACTTG
ATTGAAGAGGTTATCATCGGCGAGGATACACTGATCAAGTTCTCTGGTGTTGCGGCGGGTCAGGCTTGCACCATTGTACT
CCGTGGCGCAACAGAACAGCTGCTGGACGAGTCTGAGCGGAGTCTGCACGATGCGTTGGCTGTGCTGTCGCAAACGGTCA
AGGAGCCGCGGACGACGCTTGGTGGAGGATGTGCTGAAATGCTGATGGCAAAGGCGGTTGAAAATGCGGCAACCCGTGTG
GAGGGCAAGCGGCAGTTGGCCGTTGGCGCTTTCGCCATCGCCCTTCGTCAACTCCCGACAATTCTTGCGGACAATGCCGG
ACTGGACTCTGGTGACCTGGTTGCAAGACTGCGGAAGGCCATTTACGATGGCATGTCAACCTATGGGTTGGATCTGACAA
CTCCAGGCGGTGGCCTGGCCGATATGAGAGACGTTGGGGTCATCGAGAGCTACAAGTTAAAGAAGGCAGTCGTCTCGTCG
GCAAGCGAGGCAGCAGAGGTCAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62