GenePrediction:GLEAN_1741 Details

Name: GLEAN_1741
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:819773..821299 (+ strand)
Length: 1527
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:819773..819943 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_144:820001..821299 (+ strand)
Length: 1299
>GLEAN_1741 class=GenePrediction position=GCSC_144:819773..821299 (+ strand)
ATGGATGACAAGACCGTGCCGTCGGCGTCTGTCGAGGCGCCTGCCGCGTCTGTGCCTGCAGAGACCGCTGATGAGTCCTG
GCAGCCCAGCTCTTCGCGCCTCATGCGGTTCTACTCCCATCCATGGACGCAGATCGGCCTCATCAGCTTCATCTTCTTCT
GTCTTCCCGGGGTGCGTGTCTGACGGCCGTCCGTCTCGCCCGCTCGCTCTTGTGCTGACTCTCGGCAGATGTACAATGCG
CTCGGCGGTCTCGGCGGCTCCGGCCAGGTCGACTCGACCGTATCGGCCAACGCAACGGTGGCGCTGCTCTCGGCCACCGC
AGCCACTGCGCTCTTCTTTGTCGGGCCCATCTTCACGTTTGTGGGCCCGCGCATCTGCTTCCTGGTCGGCGGCTGGACGT
ATGCGCTGTACAGCGGCTCGCTGCTCTGCTTCAACCACCGGGCCAACGGATCGTTTGTCATTGCAGCCGGTGCGCTTCTC
GGCATCGGCGCCTCTTTTGTGTGGATCGTGCAGGGTGCCATCATGACGACGTACGTGCCCGAGGCACAAAAGGGCCGCGC
CATTGCCGTCTTCTGGATCGTCTTCAACCTCGGCGGTGGCATCGGCTCGCTGGCCTCGTTCGGCCTCAACTTTCACTCGA
AGAAGGGCACCGTGTCAGACTCGACGTACATTGCCCTCATGGTCATCATGCTCTTCGGCTGGCTGCTGGGCGTCTTCATC
TGCGACCCGAAGCGTGTCCGCCTGGCTCAGCTGCATGCTGCCAGCGAGACCGAGCGCACTTCCGTCCTCGACACCGTCCG
TATCGCCGTCCAGACCATTGCCAGCTGGCGCGTTCTCTGCATGCTGCCGCTCTTCTTCTGTGCCAACATCTTTTACTCGT
ACCAGCAGAATGACGTGAACGGGCTCACGTTCAACATCCGCAGCCGCTCGCTCAACGGCGCCCTCTACTGGATGGCCCAG
ATGGTCGGCGGCCTCGTCATCGGCATGCTGCTCGACATGCCCTGGTTCGGCCGTCCGGTGCGCGCCCGCTGCGGCTGGGT
CGTACTCTTCGTCACCGGCATGGCCATCTGGGGCGGCGGTTATGCCTTCCAGAAATGGGACAACGTTCGTCTGGCCGCCG
GCCACAAGCAGGACCTCGACTACACCGATGGCAAGGTCGCCACAGGCCCTATCTTCCTCTACATATTCTACGGCTTGTAC
GACGCCCTCTGGCAGGGCTTCTGCTACTGGCTTATCGGCACAGAGTCCAACAGCACCGGCCGCGCTGCCGTCCTTGTCGG
CGCCTACAAGACCTTCCAGAGTGCTGGTGGTGCCTTTGCCTGGCGCATCAACGCCTTGCACCGCAGCGGCATGACCCAGC
TGGCCATCGACTGGGGCTTGTGCATGGGCAGCCTGGTCATCGTCCTGCCAACCGTGTTGACGGTCAAGACGCACACCAGC
ATCGAGCAGGAGGCCGGCTTTCTGCCATCCGACACTAAGGATGGCCAGTATGTCGCCGAAGAAGCCGGCGACGTCGAGGC
AAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62