GenePrediction:GLEAN_1742 Details

Name: GLEAN_1742
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:821973..823977 (+ strand)
Length: 2005
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:821973..822443 (+ strand)
Length: 471
Type: CDS
Source: GLEAN
Position: GCSC_144:822516..823610 (+ strand)
Length: 1095
Type: CDS
Source: GLEAN
Position: GCSC_144:823816..823977 (+ strand)
Length: 162
>GLEAN_1742 class=GenePrediction position=GCSC_144:821973..823977 (+ strand)
ATGGTCCTTACACGCATGGGAGCCCAATTCCGCATACGCCAAAGGCTGCGCAACAGGTTGGCGTCCGTGTACCGATCAGG
CGGAGACATGTTCAACCCTGCGAACCTACAAATCGACGAAGCCGACCCCTTCCCCCCGCTGCAGGATCGCGCGCAGCTAG
TACACGGCTTCATACCGCCCAGGGACATACGTATTTACAACCCCGCCGCCATGATTGTGCGGAAGGCCGCAACCGTGCGT
GACCTGGGCAACGACGAGCGAGCGAGGCACACGCGCCTCTGCATAAACCGCATCGCAAAGCGCGCACTGCGTGCCGGCAT
ACGCTACCGGCGTCTGTTGTCCTTTGGCGGCATGGGTGTCACCTGTCTGTTCGAGGTCAAGAACATGCAGGGTATGTACA
ACAAATGCGTCGTCAAGATAGCAAAGCCAGACTGCGAGGAAGAGCTATACTGTGAAAAGACAATCATGAATGTAAGTCCG
ATGCACAGCATTGACACATCAAGAAAGCGATTATCCGGGAGCTGACAGGGTCCAATCGTCCAGACACTCAAAGGGGCACC
TCACATTGTCCAGATCAAGACGGCACGCGAGCTTCGGGGGCTGCCCGGTGGCTACGCCTCGCAAGCTGTGAACGGAGCGA
TGCCACAAGAACCCCCGGTCTCCGTTCGGGCTACCGATATGAACGAAGTGGATCGCGACCCGTCCATTCTCATGATGGAG
TACCTGCGTATGGGAACGCTGGGACACTGGATTGAGAAAGTCGACAGCTTGAACTCTACGCCTCCAGACGACGTGTTGTG
GCAAATGTTCGCGTGCCTGGTTGACGGCTGCATTGCCATGGCTTATCCTCCGCGGTACCAGGAGCAGAATGTGGGCAAGA
ACTCGATGCTAGAGTATGTCCCGGCAGAGGATGAGCTCCGGCGAAACAGGCGCAACCAGAAGGTATGCAACTACGTGCAT
TTCGACCTCGACCCATCCAATGTCTTGGTAGACGGCTTCGACAATGGCGAACACAACATGGTGCCGCGCATCAAGATTGC
CGACTTCGGCACCACCCTCAAGGCCGATCTCAATTTCATGAACAACAAGCAGAGGCTCTGGAGCCAGCGATTCATCGGCA
AGCAAGGCTACTTGATGCCGGAGCAGTGGACGGCAGAGTGGGAACTGGTGGAGGGCAACCCACTTCGAAACGAGCCAGAA
GCTTGCCGCATCGCCGGCTCCTTCGACGAGAGGTCCAACATCTGGCAGATTGGCATGGTCATGCTTAACCTCATCACCTG
CTTGGGGCCAGAGACTCCTCCATACGCGCGCAACGTGCGGCTGCACCGGAACGGACCTAACGACGTGTTGCATCGCGGCT
ATCGGATCCAAAACCGCGTTGTGCTGACACATGGGTACATGTTGAACGACGCCAAATTGCGGGTTGTAGAGCGCGAGCTG
CGCGAAGTTGTCATGGCCTGCCTGGCCTACAAGCCGGAACAACGGCCGCTGCTGGAAGATCTTCTGGACATCTGCGATGC
GAGGCTCCATGCTGACTTCCCCAATGCAAACCCCCATTGGGCGCCGATGATGTTCTCGGCCTTAAATTATCCGGATGAGA
AGGATCCGACCGATCCATACAACGATGCCGACGGAGCTGTAAGTCGCCTTGATGATTGACATTAAAACATTTGACGTTGC
TATAGAAGCTAACCGACTCTTGTAGGTACCAGAGCTCGACTCGTCTTCGAGCGAAGATGAAGATGATGATGATGATGACG
ATGACGATGACGATGACGATGACGATGACGACGGCAGCGACGGAGATGATGGCGATGGTGACGGAGGTGGTGGCGTTGCA
CAGGCCGGCGGAGATGGAGCAGCGCAAGGGGCTGGAGCTGCACCAGGAAACGGAGCTGCACCAGGAGGCGGAGGTGATGG
TGGTGATGGTGATGGCGGTGGTGACGGTGCTGCAGCAGGCAAGAGGCTGCGTATCAAAGTCGTGAAGCGCAAGCAGAAAG
CATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62