GenePrediction:GLEAN_1744 Details

Name: GLEAN_1744
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:838241..839844 (+ strand)
Length: 1604
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:838241..838598 (+ strand)
Length: 358
Type: CDS
Source: GLEAN
Position: GCSC_144:838655..838851 (+ strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_144:838921..838979 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_144:839038..839459 (+ strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_144:839528..839608 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_144:839669..839844 (+ strand)
Length: 176
>GLEAN_1744 class=GenePrediction position=GCSC_144:838241..839844 (+ strand)
ATGACTCTCGAACACCACCACAGCTGCGAGCCCGCCGCCAACGGGCTAAATGGGATGGCTACACGGTCAGACCATGGCTC
ACAGCCTGCCGCCCTGTCGCCAAACCTATCCGTCCTGCTCGTGCGCAAGCGTACCATCCGAATCGAGCCCATGCCACAGC
CCGTGCTCGAACGCGATGGCGTGCTGGTCCGCGTCATGGCCAACGGCATATGTGGCTCCGACATGCACTCTTACATGGCC
GGTGGCGTGGCCGGACGACCGGTGCTCGAGCCGTTGGTCATGGGCCACGAGGCCGCCGGTGTGGTCGAGGCTGTAGGTGC
CGATGTGACCACGCATAAGCCGGGCGACCGGGTAGCCAGTGCGTCTCATCAAACCATGGAGAGCTGTCTTTGTCGCTCAC
ATTAGCTCGTTCAGTCGAACCTGGAATGCCGTGCCGTCGTTGCGTCAACTGCAAGAACGGCCGCTCCAACATCTGCCTCC
ACATGCGCTACTGCAGCTCGCCCGGCACCCACGGCTCCCTGTCGTGCTACTTTGCTCTTGCAGCAGACCGGGCACCACAC
ATCCCCCCGACAGTGGGCTGGGATGAGGCCGGCAGCATCCAGCCTCTGGCCGTGCGTTTGTTTGCTTCTTTTCTTCTCGA
CATTTCTTGTCGTGTTCGCAACCGTCTGACCTGCTGTTAGATTGGCGTGCAAATAGGCAAGCGGGCCGACATCCGTCCTC
ATCAGACCATCGCCATCTTGTAAGCACCCGACGAGATGGATAGAGAACAGGAGCCCTCGCTAATCTGCCAACCCCAGCGG
ATGCGGCCCCATCGGCCTCATAACTGCTGCCGTGGCCCACGCCTACTCGGCCAGGAAAATCATTGCCTTTGACGTGCGGC
CATCTCGTGTGGACTTTGCACGAAAGTACCTGTCACCACTGACAGGTCGTCCCATCATCGACCACGTCTTCCACATCGAC
GCCATCCCGGATTTCTCGAGCAAATCGTCGTCATCTGGCAACAGTAACGGCAACGGGACAGCCGCAGCTTCCCAGGACGA
AGAGGACGCAGAAGAGACAGTCGGTGACAAGATGTGGTTATGCGCGCAGGGCCGCATGCGAGAGATCATCGCCCAGTGCG
GTCTGAAGTCCGAGGAGGGTGTTGACCGAGTGGTTGAGGCCAGCGGAGCGCAAGACGCCATTCTGCATGGCGTGGCCATC
TGCAAGCAAGGCGGTGTCTGTGCGTACTTTTCTCTTCCACCGATCATTATTCAACTGGCAGTCGTACTGACCTTTATTCT
CGCCCAGTTCTCCAGGTTGGCCTCGGTCATGTCCAGACACATCTCGTACCCACTGTTGCTATAACAAACAAGGAGCTCGA
CTTTCGAGGTAAGTGTTGTTGCTGCTCTGACTGGCGTGCTGGAACTGCCAGCAGCTGACAACTCCCAGGACTCACCCGGT
ACACTGCGTCCTGTTTTCCATCTGCCATAGACATGTTGGAACGCGGTGTGGTTGACCTAAAGCCTCTCATCACCGCGACC
TTTCCGCTCTCACGCGCCCAAGAGGCCTTCGAAGCGGTGGCTGGCGGGAAAGAGATCAAGGTTATTATCAGGAACGGGGA
ATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62