GenePrediction:GLEAN_1745 Details

Name: GLEAN_1745
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:840742..841539 (+ strand)
Length: 798
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:840742..841260 (+ strand)
Length: 519
Type: CDS
Source: GLEAN
Position: GCSC_144:841369..841539 (+ strand)
Length: 171
>GLEAN_1745 class=GenePrediction position=GCSC_144:840742..841539 (+ strand)
ATGGCGACCGTGCAGGACCAGATTGCGGTTCCGGGCCAGCTACTGGGCCCGGCCTCGCGCTTTGTGCCGGGCGCGGGCAC
GCATCTCGCCGACGGCCAGGTGTACGCATCGCTGCTGGGCCACGTCTCGGTGCGGCAGCCGGCCGAGGCGGGCAAGAAGA
CGGCGATGCTGCCAAAGCGGCTGACCCGGATCATGGTGCCGTCGGTAGCGACAAAGGGGCCGGACGGGGCGGCTCAGGGC
TCGTCGCTGGCCGACGTGAACAAGGCGACGGTGTCGGTGTCGCGGGCGCGAATCGCGCAAGGCGGCGAGGTGCTGCCGGA
CGTGGGCAACACGGCGCTATGCCGGGTGGTGCGGATCGCACAGCGGCAGGCAGTGGTGGCGATCCTGGTGGTGGGCGACG
TGGTGCTGGAGGCCGAGTGGCAGGGCGTGATCCGGGCACAGGACGTGCGGGCGACCGAGAAAGACCGCGTCAAGATCTAC
GAGTCGTTCCGGCCGGGCGACATTGTGCGCGCGCAGGTGGTAAGTCGTCTGTGGTGTGTGTGGGCAACATGTCTACGTCC
ATCCTCGTCCTCTGCATCTTTACCTCCATTCCCATCTCTATCTCTATCCTCCCACTAACCCATCCAGATCTCTCTCGGTG
ACCAGGCAAACTACTACCTCTCGACGGCGAGCAACTCGCTGGGCGTGGTTATGGCGACGAGCGAGGCCGGAAACCCAATG
TACCCGGTCAGCTGGAAGGAATATGTCGACCCCGAGACCGGCCTAAGCGAGCCCCGCAAGGTTGCCCGCCCCTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62