GenePrediction:GLEAN_1747 Details

Name: GLEAN_1747
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:846126..848289 (+ strand)
Length: 2164
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:846126..846348 (+ strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_144:846403..846683 (+ strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_144:846742..848117 (+ strand)
Length: 1376
Type: CDS
Source: GLEAN
Position: GCSC_144:848184..848289 (+ strand)
Length: 106
>GLEAN_1747 class=GenePrediction position=GCSC_144:846126..848289 (+ strand)
ATGGCTGGACCGTCGGCGCAGGTCAAATGGACCCCCGAGGCCAGCATCTTGAAGCCAATCGACGCGACAGTCAATTCTGA
CGAATGGCCGTCCTTTTATCTGACCGACGCTGCAATCTACAGCAAGGACGGTACCTCACTTGCCAATGCGCTGCTCGTCG
GCACCGAAGGCCCCTTTGTCGTCCGTGGCAAGCTCGAAGGCGAAGAGGAAGACGGGTCGCAATGTGAGTGAATGTTTCTC
GTCTTTCTTCTTCACACCCCCCCCCTGACACCACCAGTTGTCCGCCCCGACGTCCGCTCGGCCAACATCGAGATCAACGA
CTGTACCCTCTACTCTCTCGGCTTTGATCCCCTGCCGCTCGTCTGGGTCTCTGGTCATGCCGGCTGGTTCATGATCAACC
CCAGTCCCACCTACATTCCCTTCTACAATGACATCTGCGACGTCTCCGTCCTGTACCACCACATATCCGAGATCTACAAC
ACAGCCGTCGAAAACGCTGCCAAGGTTGAGAAGAAAAACGTCTACGCCAACCTCTCCACCAAACACATCCTGTTCGAGGT
TCGTCTGTCTCCCATCGTCTGCCAAAATCCGTTTCCTAACCCCTCTTCACCTGTAGTATGCCGTAGCAGTCGGTGACGGC
ATCACCTACGACGAGCTGGTCGACAAATGCGTCCGCTTGGCCCCCTTGCTGCTCGCCCACTTCGCGAGCATAAAGACGTT
CAACTGGAAGACAACCGGCTTCGTCAAGTGGTTGACACGGGAGATACAAGATCGAGGCCGTACTGACCGGAGATCAAGCC
GCGCCATTTCCGTCACAGACAACCGCTCACAATCATCTCCCGCGCCAACTGCAGTGCCGTCGTCATCCGCACCTCAGCCC
TCCTCCTCCTCCTCTTCCACAGCACGTCCGCCTTCTTCGCTCTCCCACGAGCTGCCGCTCCGAACCCCACCACGATCTTC
GCTCAACTCGAACCCGCCTCCCGATCCACCATCGACAACAGCACAACCCGCTGCAGCCACATCCGACGCGCAGACAATGG
ACGAAGCCGATGGCCGTCATGCGGCTGCCCTCCGAATGCTCCTCGACGGCATCCTGGAGATCGGCCGAGACTTTCATGGC
GACGTGTCGCGCATCAGCCAGTCTCACATCCACGGAAAGCTCTACAACAAGTTCCGGCTCAAGTTTTATACCGTCGCTAA
GGATCTGTCGGCATACTTTGCTACGGAACTCTTGGCCGCACTGGACCACGAATGGGCTGAGTCTCCGTACGGCCTCTGGC
TTCGCACTGCCAGCTCGCAGCCCTTTGTCCCCGTCTCGCCCGACTTTACTGTTCGTGACATGCCCAACCAGCTTGTCCGT
CGCGCCGGCCATATCAACCAGCGCCAGAGACAGGGTTCCGCAACCCCGACAGCGTCTTCTACACCACTGCGCCGTGACCA
GCAGCGATCGGCCGGCAAGGCCCTGCCGTCTGCCCTGAGTGCTCGCCGTGGCGGCAAGCACGCCGCTCTGCGTCTGCCGC
TGGCCTCCAAGAAGCGCCCGCACGGCAGCGCCTTCTCCAACGACAACTCGGACAACGACTCGATAGACGACGGCGACGAT
GCCGGCACCAGCAGCAGTGCCGACGCTCGGGGTCATGACGCGCGTCGGCGAAAGCTCGCAAACAAAAACGAAAACGAAAT
CGGCAACGACAACGAGACCATGCTCGTCGTCCGATCGCAGCCGCTAGCCCAGTCCACTGCGCCGACCGGACCCAACCGGA
CCTGGCGTTGCGCCCGGCCGGCCTGCGGCTTCTTCGTCCGTGATGCCGGCCCCAACTTTGGCACAGGAGGTGATCTCGAC
GACGACAGCAGCGACGATGACGATGAGAGCCACGACCATGTCAAGATCGCTCAGGAGCTTGTGCGCCAGCACATCCGCGC
CCACGAGCAGGAGACGCTGAACAAGGTCGACCTGGCCATCACCGAAGGCTCGCGGCGCCACGTTTCCGTCAGGTATGTTC
CTCACGTCCATTCCTCGTCTCTTGCCCGTTGTCGAGCCGAGCGCTCACATCCGTCCAGTCACCTGTTGGACAAGATTCGC
AACATGGGCGATACGAGCAGCGGTGGACCGGCTATGGATGGCGTCGTGGCACCGAGTCCGATTGTACGGCATTTCCTCGT
GTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62