GenePrediction:GLEAN_1749 Details

Name: GLEAN_1749
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:865720..869938 (+ strand)
Length: 4219
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:865720..866112 (+ strand)
Length: 393
Type: CDS
Source: GLEAN
Position: GCSC_144:866174..868657 (+ strand)
Length: 2484
Type: CDS
Source: GLEAN
Position: GCSC_144:868722..868907 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_144:868985..869938 (+ strand)
Length: 954
>GLEAN_1749 class=GenePrediction position=GCSC_144:865720..869938 (+ strand)
ATGCCGTTGCCAGCAAACAAGAAAATCACTGCTTCGTCTTCGTCTTCGTCCTGGAACGACAGCCCGGACGCCTGGTCAAT
GCCGGAGACCGGCCGCGCCTCCCGCCGACACACGCCCCGATCGACCTCTGCCGCACCCCGGCCACGGCCTGCACCGCCCT
CGAAGAAGAAACGACGCCCGCCCAGGACTGCTGTGCCAGATTCGTCCAGTGACAACGGCAGCGCCATCAGCCCTTCCGGC
GCCCACGACAGCACCACCGCCGCTGCGGCCGACAACGACGCCTGGTATGCCATCAAGGACATCATTCGACAGCGCACAGT
AAAGCGCCGTCTCGAATACCTGGTCGACTGGGCCGACCATCCCGAGACCGGCGTGTCCTATCCCCCGAGTTGGGTGAGTT
GGCAAGACGGCAGCTTGCTGGAGACCCTGATCGAGATTGAGGCTGACCGTGCAGATACCCGCCCGAGACGCTAGCAGCGA
CGCCGTCAAGGCTTGGAAGGCGTCGAGAGCCGCACTCAGCAGCACTGCCGACTCGCTTGTCCACGAGAGCTTCGAGGACG
CAAAGACGCCTGAGTCTTCTCCTGTGGCCAAGCGAAAACGAGATCGATCTGGCTCGCCGTCCGAGAAAGACACCACCCCG
CCCACCAAGAAGCAAAAGGGTCTCCGCGAGGTTCCCGACCTGCATCCAGTCCTCTTCTCGTCCGATCCCTTTAGCCGGGA
CGCCAGCACTGAGAGCCCTGAGCTCGAGCAGCCCCAGCTTCAGCTTCAGCTTCAACCTCAGCCTCCCGTTCGATCTGGCA
AGGATCTTGCCATCGAGCTCAATCCCGTCGATCCCGACGACTACCTGCGCTTCTCTCAGCTGCAGTCACAATCGCAGTCG
CAGTCGCAGTCGCAGTCGCAATCCCAGCCACTCCTACAATCTGACTCAACATCCCACCCACAGTTCCACTCTCTTCAGCC
CAATCCCTCCAGTCGACCGTCTCCAAGGACTATCCCCGACTCTGAGATAGACACTGCCTCGCGCAACTCCATCTCCACCC
TTGAGCCTCGCTCTGCTGCCGTGACGCTACCCAGTGCTGCCGCATCTTTGCCCTTCTCCGGACCTCGTCTCTCGCCAGCT
GTCCTGCCGTGGGATCCCACCCAGCCGTCGGAAGACCGGGCCGGCAGCGGAAGCGAAAACTCTCTCTTCTTGACCCAACC
TGAGGCTGACTTTGATCTTCTGTCCGAGTTGCACTCTCAGCCGGCCCCAGCATCGCCCGACCATCGCGGCTGGAACCCCT
CAGTCGTGCCCGACTCTACCCGACGTAACCAGTTCGACCAGCTCGACCAGCTCGACCAGGATACTCATTCGGCCCACGTC
GTGCGTCTGCTCCAGAGCACGCATCGCTCCCTCTTCTCGGACCCGTCTTCCGAACCGCCCAGACCGCCGACGCCCTCTCA
GATCGACGGTGACGACAGCTACCTCGACAACATGGACGGAGACGATCCCTCCATGGACCCGGTCGCCCTGCTCCGAAAGG
CCCAACGCGACGCGCTTGGCCCCGAAGGCCTGGCCATGACCGAGCTGCCGTCCGACACGATCAGCCGTTTCTTGAGCCAA
GACGTCCATTCGTCACCGGCAGTCGGTGATGCCGCCACTGTTGCCGATGCCCGCTCGCCGGTGCTGCCGCTCTTTACAGA
ACAGGTGGCTCTCGAAGTGGGAGCTGCTCGCCCGCCTACCATCGACACGGCGCTCCTCGTCGGCCCCGAGACGGCCATGG
CCCTATCGCCGACGGCGCCCGTGCTGTCGATATCACCCGAGCCGGCCGAGCCGGTCGAGCAGCAGCAACAGCAGCAGCAG
CAACAGCAGCAGCAGCAACAGCAGCAACACAACAGTCCGTCGCCGACGTCAGGCTCAGACATGACCGACAAGGCCGACAG
CCCGGCATCGACGGAGGCGGCCGACCGCGAGCGGGAGTCACTCTCGCCGTCGGTCTTTGCCTACACGCGCGAGTACACGG
TGACGCTGCCGCTGGCGGCCAACTCGCGGCAGCGCTACATTGACGTCGTCATGGACAAGGAGAACCAGAAGACGATCAAG
GCGTACGGCGACGTGTTTGTGCGCGACACGCGCGAGCTGCCCGGCGCTGAAATCACCGGCCGCGTCGATGCACTGCTGCA
GAAGCTGCTGGACCTCGCCGACCTGCCGCCTTTTTCCGACAGCTTGCCGGCACTGACGCGCGAGGCGATGATGAAGTATG
CGGCCAACACCAGCGGCAAGTTCACGTTCCTGCACGAGCTGCTGGCGCCGATCCGTGCCGTCGACAAGAAGGTCCTGATC
CTGGCACGCAAGGGCGTCGTGTTGGACTACATGGAGGCGCTGGTTGGCCAGCTGAACGTGCCGCTGGTCCGCATCGGCCA
TGGCAGCAGCGACAGAAGCCATCAACACCAGCTGTCCGTCATTCTGGCCGACACCGAGGCCAGTCCAGCCAGCCTGCCTC
AGGACGTCGACTTTGTCATTGGGTTTGACCACACGGCACGCACGTCGGGCCTGCTGGCAAACTACCTCGTGGACGTGGCC
GGCCGGCCGTCCCGGCCGGTGGTGCTGCTGCTGGTCGCCAATTACACGCTCGAGCACATCGACTTGCGGCTGCCGCTCAG
CAACGTCGGCGACCAGGAGCGCAAGAACGCGCTGCTGCTGTGCACACTCGACTGCCTGCCGTACCTGCAGGATGCAGCCT
ACGACGACCAGCCGGTCAGGCCGCACGAGGCGGCGGCGGCGTTTGCCAAGGTGTTTGCAGACCCGCGCGTCGACGTTGCG
TGGAAGCCGCTGTCGCTGCCCGACGACGTGTTTGACACTTACATCTCGTCGTCCGGCTCGGAACACCCGGTGCTCAGCCA
GGAAGAGTCTTCGTCGCTAGCAAACGTGCTCGGTGGCTTCTCGCGGAAGCACCAGCTGGTGAGCTTCTCTCGTTTTTCTT
GGTCGTTTCTCCTCCTCCCAATACTGATGGACTAATGGACAGGATGATGATATCGACGATGACGACGCACAGAAACGAAC
TCGCCTGAACGGCTTTGCGTCGCCGATCGTGCTGAACCAAGACTTGGCACTGAGTGACACGATCAAGAAAGCGCTGCATG
GACCGCTGACAACGAGCGGTACGACTGTGACGATTGCATTGTCGCAGCTCGAGGCACTCGCAGCTCGGGTGGGTTTTTTT
TTTTCTCTTTTTTCTTTTTCTTTCCTCTCTCTTTTTTACCTCCTGAACAAAGACTAACCAGACAGACGGTGGCACTGGAA
AGTCAGCTACGCGAAAAGGAGATCCAGGAGGCCATGCTGCTGGAGCGAGTGCGGACGCTCGACCGACAGACCAAGGACAC
AACGGCGACGATCGTGACGTGCGAGCGCAAGCTGCTGGAGGCAGTCAAGGACCGGGGTGTGTTTGAGACCGAGCGAGACC
GAGCGACGCGGGAGGCCGAGGCAGCAAAGGAGCGCCTAGCATCGCGAGACAGCGTCTTGGCCGAGCTGCGGACAGAAAAG
ACGTCGCTGACGGAGCGGCTAGCCGAGGCGACGACGCTGCTGGCCGGCTCGGTAGTGCCAGAGGTGGCCCGACTGGCGAC
GGCCGAGGCAGAGACCGAAGCAGCGCGGCGCACGATCGCGACGCTAGAGCGCAAGGTAGCCAGCACCGAGACGGACCTGG
CGCACGCGCGACGGGCGTACCAAGACGCATCCAACGCGGCGGCCGACCTGAGCGCCGAGAACCGTGATTTGACGACACGC
AACAAGGAGCTCGGCCGGCTGGCAGACGAGAACCTGCGGCAGATCCACGAGACCAACGCGCACAACGAGACCGACGAGGT
CCGTCGCCGCTGGGCCGAGATGCAGGTCGTCATGCGCGAGCGCGACCGCGAGCTGGAATGGGCCCGTGAAGAACTGCGCC
TGCTCAAGAATGGTCGCCGCGAGACGCGCGCCCAGAGCGTGCCCCGGAGCCCTCGGCTCGGCGTCATGAGCCCGCGCACC
GTCGCCGGCCGCATGGCCACTACCCCTGGAGGTGCCGGTGCCGATCGCAGCAGCAGCAGCAACAACAACGGCCACAGCTC
GTCCGTCAGCCGTGGCAACAGCCCCATCGCCGCCAGCGTCGACGGCTCCAACCCGGCGGCTCCGATTGGCCCCGTGGCCG
GGCTCACGTACCTCAACCAGCAGCAGGGCGGCAGCCGCTGGACCCATCTGCGCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62