GenePrediction:GLEAN_1750 Details

Name: GLEAN_1750
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:873504..874729 (+ strand)
Length: 1226
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:873504..873917 (+ strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_144:873988..874057 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_144:874114..874326 (+ strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_144:874389..874729 (+ strand)
Length: 341
>GLEAN_1750 class=GenePrediction position=GCSC_144:873504..874729 (+ strand)
ATGGCTTCAGTCGCCGACCTGTTCCAGGTTGGGATTCCCACCCTGGACCGACCCTTCGGCCTGAAAATATGGCCCATCTT
CAGCAAGGTCTGGGAGCATTTTCTCGGCTATCCTGCTGAGGACTTCAGATTTGTGCCTGGCCAGACACCCATGTCGACCC
TGACCGAAACAAGCATATTCATTGTTGTCTACTACTTCGTCATCTTCGGTGGCCGCGAGGCCATGCGTGGGCGAGAGCCC
TTCAAGCTCAAGGCTATCTTCCTTGTCCACAACTTTGTGCTCACTGCTGTCAGCGGCCTTCTGCTGGCTCTCTTCGCCGA
GCAGATGATTCCCACAGTTACGCGCGAGGGCATCTTTCATGCCATCTGCCACAGGTCCGGTGGCTGGACGCAGCCACTCG
TGGTACTTTACTACGTGAGTGATTAGCCCATTACCCCAACAGCCCTCAGCCGGAGGGGGATGGAAGGCTAACAAACCATA
CCAGCTCACCTACCTCACCAAGTACCTCGAGTTGCTTGACACCGTTTTCCTGTTCTTGAAGAAGAAGCCATTGAGTTAGT
CACCCTCCGGCTTCGCTCTTTTCGAGAGCTTTAAGTACTAACGAGGACAGCCTTCCTCCACTGCTACCACCACGGCGCGA
CCGCGCTGCTGTGCTATACCCAGCTGCTCGGTTCGACCGCTGTGTCGTGGGTGCCCATCACTCTGAACCTTGGTGTTCAC
GTTGTCATGTACTGGTACTACTTCCAGTCCGCCCGTGGCATTCGCATCTGGTGGAAGGAGTGGGTCACCAAGTTCCAGAT
CGTCCAGTTCGTCATTGATCTCGGTACGTTCCATATATTGTACGCTTTCCAATTGTACGAGCAGGTTGCTAACTAGCGTT
TCCAGTCTTTGTGTACTTCGCCTCGTACACTTACTTCACCTCGACCTACTTCCCCGACTTCCCCAACATGGGTTACTGCG
CTGGCGAGGAATTTGCCGCTTTTGCCGGCATTGGGATTCTCAGCTCGTACCTTGTCCTGTTCATCTCGTTCTACCTAGCC
ACTTACCGCAAGGATGGCAAGAAGACGACTTCTAGGAAAGCAGTTCGCCGCATGAGCCAGGCGCCCCTGCCTGACCCACA
CGATCTCCTGATCGGTGGCAAGCCGCAAGGCTCTGTTGCGTCGACCACTAGTGCCAGGCCGACTGGTAAGACCAGCGGCA
TGGTCACTCGCTCTCGCAAGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62