GenePrediction:GLEAN_1752 Details

Name: GLEAN_1752
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:904353..906618 (+ strand)
Length: 2266
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:904353..904508 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_144:904577..904634 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_144:904849..905165 (+ strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_144:905225..905557 (+ strand)
Length: 333
Type: CDS
Source: GLEAN
Position: GCSC_144:905632..906618 (+ strand)
Length: 987
>GLEAN_1752 class=GenePrediction position=GCSC_144:904353..906618 (+ strand)
ATGGCAACGACGCAACAATCGCCGCTATCTATTGACCGCTACGTCGTCATTCACGTGGCTACAACCTGTGACGAGCATGG
TGTGTACGTGACGAAGGATTCGGCCGAGGTCATCGAAATTGGCTGGATCCTGCTGGACGCGAAGAACCTCGAAGAAGTAG
GAGCCCGCCACGTTCCCGTTTACCGCTCGAGACAGCCCGCTGACCTGTCTTCTCCGATCTCTAGCTGTACAGAGAGAGCG
TGTTGGTCAAGCCGATCAACACACCCATAACCCCACTTTGCAGTAAGTCCTGTTCGGCAGTCTGTCCGAAGAAGAAGGAT
GATACCCCGGAGCTTGTGCTCGTGGGCTGTCCAATGGGATGGGAAGGCGAAGAAAGGCCGCAAGCCCGTCCGGGGGGTTG
TCTGTCCAGGCACCGAGCTCCGCCGGAGCTCCTGCTGCTGCTACCCACATTTTCTCTCCTGCATTGTGGCTCCAGTTCTA
ACTGTCAAACCTGCAGCGAGCCTGACCACCCTCACCTGGGAGCACGTCCGTAATGCGGGCACGTTCCGTGATGCCATCAA
CCGCTTCGATGCCTTTGCGTCGGAACACCTCACTTCGCAGAGCCTGGACTTTGTCTTTGTCACCCTCGATGCCTGGGACC
TTCGTGTCCAGCTGCCCCGGGAGGCCCGCGACAAGGCCGTGGTGCTGCCGCCATACCTGCAGCACTCGCGGACATTCGAC
CTGCGACAGGAATACCAGAGATGGCAGCAACACCACCCAGAGTCGTTGCCGTTCGGACCGTCGTCGCTGAGCAACATCTG
TGCCGCCCTGGAGGTCGAGGCGGTCCAGTCGAGAGGCCCCCCATCAAGCACAACCTGCCGTTCCACCTGCAGGCGCTGGC
GCCGGCGTCTCCACGCCGCGCCATGGAGGAGGCCGTCACGCTTGCCCGTGTCCTCCGCGGACTCATCCGCAAGTCGCAGC
CGGCCCATGAGCACCCCGACGTGCTCGCCCGTCCCATGGATGCTAGAGCCGACGTGCGGGCGTTTTTGTCGGAGCGCAGC
AAGGTCCTGCACATGTCTGGCCTCCCACACGACACCACGCAGTCGGAGCTTGAGAGCTGGTTTACACAGTTTGGCGGCCG
TCCCATCGCCTTCTGGACGCTGCGCACGCCCGAGCAGCACAAGCCGACCGGGACCGGCTTTGCGGTGTTCTCGTCGCACG
AGGAGGTGGGTTGCTTTCTGTGTTTCCGCGTTCTCGGTTTTCGTGCATTTGCAAGCTTTATCTGACTCGTGTGATCTAGG
CGGCCGAGAGCCTGTGCATGAACGGACGTGCCCTGAACGAGAAGGCCATTGAGGTGTCTCCGTCGTCAAGCCGGGTGTTG
GACCGGGCTGCCGAAATCCTGACGCCTTTCCCGCCAAGCAAGAACCGGCCGCGCCCGGGTGACTGGACATGCCCTTCGTG
TGGCTTCTCAAACTTCCAGCGCCGTACTGCCTGCTTCCGGTGTTCCTTCCCCGCTGTCAGCGCCGGACCGACTGGAGACA
TGGGTGGTGGTGGTGGCTACGGCTACGGCTACGGACCCCCGGCCATGCTGCCTCCTCAGCAGCACGTCGGCCACCACAAC
CACGGTCACGGTCACGGCCACGGCCACATGGGAGGCGGCGGCCATGGCGGCGGCCGCATGGGTGGCAGCGGCGTAGTACC
TTTCCGGGCGGGCGACTGGAAGTGCGGCAACGAGGTCTGTGGCTACCACAACTTCGCCAAGAACGTGTGCTGCCTGCGCT
GTGGTGCAAGCCGTGCCAGCGCGGCTATCGTGGCAGACTCCGGCTACGCCTCTTCGATGGACACGTCAGCCTCCTACAAC
ATGGGCCAGGCTTCGATGGGCGGCACGCCGGGTCCGGGGGCCTTTGGCGGCGGTGGCGGTCCGTTTGGCTCGGCTGCCGG
GGCTGGCGGCTACGGTCAGCAGTTTGGCGGTCCTCCGAGCACGTACGCTCTGCCGTCGGGTCTGGGAGGCAGCGCCGCAG
CGCCGTATCCGCCGCTCAACACGCACTTCGGCCCCGTGTCGGGTGCGCACTCGGCTGGCCCGTTTGACAGCCGGGCTGCC
GAGGCGGCTTTCCAGTCGGCGACGAACGGCCCTGCATCTGCCGGCCCGTCCAACAACTTTTATTCGCAGGGGGAGAATGA
TCCGTTCGCCTTCCTCTCGTCGGGCATCGGCAGTCTCTCGGTGGGCACAGCCGGCGAGGCTCGTCAGAACGGGTCAGGGG
CACCGCCCAGCAAGTCGCCCGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62