GenePrediction:GLEAN_1753 Details

Name: GLEAN_1753
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:924432..926408 (+ strand)
Length: 1977
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:924432..924849 (+ strand)
Length: 418
Type: CDS
Source: GLEAN
Position: GCSC_144:925016..926253 (+ strand)
Length: 1238
Type: CDS
Source: GLEAN
Position: GCSC_144:926316..926408 (+ strand)
Length: 93
>GLEAN_1753 class=GenePrediction position=GCSC_144:924432..926408 (+ strand)
ATGGGCTTCGATAACCTCATGTGGCACCTCGACGAGGGTGTCACCGACCTGTTCGGCCAGTGGAATGTCTACTCGAGCGT
GCTGGCGACGCTGCTGATCGGCATCGTCAGCGTCTTTCTGTACGTGCGCCGCGATCCCGACACCCACCCGCTGCTGCTAG
CGCGCCAGGCCCAGGGCTCGCCGGTGCGCCAGGAAGGCGAGTCGCCCGTGTACCGGTCGCGCAGCTCGCCGCACTCGGTC
CCGCTCCAGTCGGGCCTGGACGTGCGTGATCCGGGCGTGTCCAAGTGGGCGCGCGGCCGTGACGGCGACCTGCGGGACAT
CTGGCGACAGGCCATTGCGGGTGGGAGCACCAACAAGAACAGCCGTGGACGTGTTCTGGCCGTCTACGGCACCGAGACCG
TGCAAGAGACTAGTCTAGGTACGTGTCTGTAGCCGTTTGATGGAAATGTCCATAAGCCCAATGGCTTCGTTGTGGATGGT
TCACCCTCATCTCTCCTCATCCCCTCATCCCCTCATCCTTCCTCATCCCCTTCTCATCCCTACAACTCATACCTCCAACT
TATCCTCCTACTGACACCCCTCAGACGACATGACCCGACAGATTAGCCTCATCGGCCAGCACATGCTCGACCAGGGCGGC
AACCGCGTGGCCATCTACCTACCCAACTCGGTCGAGCTCCTGGCTGGCCTCTTCGCCTGCAGCTTCTACAACATGACTGC
CATCCTGCTGCCCTTTGACCAGACCGACGAAGCGCTCGTTTCCATGCTGCGCCGCTCGGCTGCCGACACCGTCATCACCG
CTCCCGGCTGCTTCCCCTTTGCCAACGTGGCCAAGAGCTACCCGGCCCTGCGCCAGCTGATCTGGGTCGTCGACGAGGGC
AGCAAGCACCTGGACTGGAACGAGGTGCCCGAGGGCGTTGGCGGCCGCGTCAACGTGTCCACCTGGCAGGACGTCGTCGG
CGATGCCGCCCCTTCCGCCGGCCTCAGCCTGCCGCCTTTGGAGGAACAGTCAGCAGCACGTGACATTTCTATTTTCTGGG
AGCATGAGAAAGACAGCATGACGACCACGACGACCACGACGACCAAGACCACCACCCTCCCCTCGGACATGGTCCGCTTC
ACGAGTGCAAACCTCTGTGCTGCCGTGGCCGCCCAGCTGTCGGCCCTTCCCGGCACGCAGCGCTTGGGCCCGTCGGATCT
GCTGCTTGTCGCCGACTCGCTGACGCACACCCACACGCTCGTCCTGGTCCTGGCTGCCCTGCATGCCGGCGCGTCTGTGG
CGCTCAGCAGCTCGGCCCCGGCTGCTCTGGACCTGACGGCCGCCACGCGCGGCATCGCGCCCACCGTCGTCGTCGCTGGT
CCGGCCGCCCTGCTGCGCACACACGCCGACACCGTCGCCCGCCTCGCTGCCGTCCCGCTTGCCTCGCTTCTGCTCCGTTG
GGAAACTCGCTCGCTCTCCGATGGTGGCGTCTTTTCCGAAGTCGTTTCGCTCGCTAGCCGCCTCCTCGATCGCGCTCGTC
CTGCCATTGGGACTGCTCCCGGCAAGCTTCGCCTCGTCTACACGGCCGAGCGCGCTGCTGCCGGCACCCCCCCTCTCTCG
TCTACTGTGCTCTCTGACCTCCGAGTCTTCACTGGGGCTCGCGTTCTCTACGGTCTCGCCGCTGCCAAGGTCGCCGGCGT
CGCCGCCCAAACCGCCTTCTACGATTACCGCGTCGTCGCCGGCGGGCCCTACGCTCCCTTCGGACCCCCCCTCACCAGCA
CCGAGTACCTCCTCAAAGACACCGACACCTGCAAAGTCGCCAACCACAAGCTCCAGGGCGAGGTGAGTGCTCCCCAGAAC
AGACACCGGATATGTTTAGTTATGGTATGTGCTGACTAATCCAGATCGTTATCCGCGGCCCCTCGGTGGCTAACAACGAG
GCTGGACTCGGCGTCATCGGCGTCATCCGGGACGACAACACCCTGGCCTACGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62