GenePrediction:GLEAN_1754 Details

Name: GLEAN_1754
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:929830..933664 (+ strand)
Length: 3835
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:929830..929964 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_144:930218..931406 (+ strand)
Length: 1189
Type: CDS
Source: GLEAN
Position: GCSC_144:931473..932387 (+ strand)
Length: 915
Type: CDS
Source: GLEAN
Position: GCSC_144:932555..933116 (+ strand)
Length: 562
Type: CDS
Source: GLEAN
Position: GCSC_144:933181..933664 (+ strand)
Length: 484
>GLEAN_1754 class=GenePrediction position=GCSC_144:929830..933664 (+ strand)
ATGTTCTCGGGTTCTGAGGGACGGAAGTCTGTCGACAGCCTGTCGTCGCTGTCGAGCATAACCCACAAAGCAGACTTCCC
TTTCCACAGGTACTTTGCGCCTCCGGCCATCCTGTGGTCATCCCCGGACCTCATGGTCTGCCCTCAGTCTTGCTAACACA
TGTGTTCAAGGCCATACTCCTCAAGCGCGTATGTGAAGCAAAGGCGGGAGTCGGTTTCAAGCTCCATCCACTCTGTCGGG
GGCACCTTAGACACGGCCATTGGCAGTTGGCCGGAGCCGTTGACGGAGCTAGGTCAAAATGGTTTGCTGCCTCGTGCCCT
CTACCTTCTGCTTCCTGTACAGTTCATCGGTTGTCTGACAAGTACCAGCCATCTCGACACTCCTCCAGCCACCCATCGTT
CGGACCGGCCTTCAGCCGCACACATCCGCCCCGGCGCATAGCACTCACAAGCCTCCGACAGCCAGAGACATACCCCCTGT
GACTCTCACGAACATTGCCCACGTCGAGTCATCCGAGTTTGCCGAGTACCTCACCCAGGTGGGTGCACTGCACGAGCAAC
TACGAAGAGTAAAAGAGAGCGAAGAAGAGCAGGCAAGTTCTGGTGGAACACCTCGGAGGAACAACAGCAAAGATGACCTT
CGCGACACATTGAGTGATGGGTATCTGCGTCCGGGCGGAAAGCGGCCGTCTAGAAGACTCTCTGTTTCTTCCATATCGTC
CGTCACGTTGGCCGAAGCGCCCAGTCCTTCTAAAAGAAACCCGAGCAACAGCAGAAGGGGTGTCCAAGGCCCACCACCCT
TGTCGACCATTCCCAATGTCTACTTCGACGACGACTTCCACCTGGAGAATCCCCGGACATTTGACATCGTTAGCGAACGG
TCTGAGGTTGTGCCGTCTGCTCCGACGACAGGCAACGAGAGAAGTGGTCTGAATGGCAATAGCACATCGATTGTGGCACC
CGTACCTCGAAAGGCTCTGGCCACGAACGCAATATTGCAGGAGAAGCTATCATGGTACATGGACACGGTCGAATTGCACC
TGATCTCATCCATCTCCACGGCATCGACTGCCTTCTTTACGGCCCTCGGCGCTCTCAAAGAACTGCACACCGAGGCTGCA
GGCTCTGTGGATAGGATACAGGCGCTGCGGAAGGAGCTTGGTGCTCTGGACCATGACATTGCGACCCGCGGCCTGGAAAT
CGTCCAGCAACAGCACCGGCGCCAGAACATACAACAGTTCCACGCGGCTGTGATGCAGCTAAAAGACATCGTAGATGACG
TGGCAGCATGCGAAGCACTTGTTGACGATAATGAGGTGGACAAAGCACTAGACAGTATCGATGCCTTGGAGATGCTCATT
GCTGGTGAGCAGGACCCAAAGAAGCAGCAACAACGGCCGTATCCGCTTCGAGACCTGCGGGGTGCGACAGCCTTGCAGGG
CGTCAATGACGACATCACAGCTCTGCGACTCCGGATTGGCAAGGCATACGAGATCAAGTTTGTGTCCGTCCTGCTCAAAG
ATCTTCGGAACCACACAGAGACAGTGCCGCGCCCAGAAGTGCTTATGCGGTGGAGCAGTGCGTCTATGCGCGCTCGGGGA
GCACACAGACGTGACCCGTCCGCATTCCCTGCATATCTTGCAGCGACCGATGATCTCCGGGCAGAGCTCCTCCCCATCCT
CGCGGGCCTTTACAGGGCCAAACATATTGCCGCTGCTTCGCTTGTGTTCCGAGAGACGGTTTTACGGGAGATTAAGAATC
TGGTCCGGAGGCCACTGCCGAGCTCAAGCGACGACGACAACGAGTCGATGATGTCGTCTTCAACGCTAAGCAGCAGCAGG
CGCTTATCTCACGCGGAGAAATCGTCTATTCTTGCTCGCAACCTTCGGGCACTTGGTCCCGAAGATGCCGAAGAGCTGCT
GATGAGGATATACATCGGCGTAGCAGAGACACTGAGACGACTGACTACGCAGTTGAAAGTGCTGCTTGACGTCGCCAGCT
CTGTTGGCGATGACATCCTGGATCCCGACGCACCGCTCAAGTCGCCGCCATTCAGCCCTTCAGGCCGCCAGATGCCGCCG
CCCATGTCGGACGCTGGCATGGAGGCTCAGGCAGAACTCCACCGGACTCTGGACATGGGCAATCTGCTCGGCCAGTCCAT
CGACGCGGCACAGGACAAGGTGATCCGGGTTCTACGTGTCCGTGCAGAGCAGAGCTCGCACCTGTCGTTCCAATGGTTCC
TCCGCTACTTCGCGCTCAACCTGCACTTTGCCAACGAGTGCGAGGGCATCTCTGGACGTAGCGGTCTTGCACTCAAGACT
GAAGTGAACGGGCACGTCAAGGACTTTGTGCAGTACCACGGCGACTCACAGATGCAGAAGCTGGCGCAGGGAATGGACCA
GGACCAGTGGGCAGCACGAGACTTTTCGGAGAAAGACACGAAGCTGCTGCAACAGATCCTGGATGCCAGCACCAAGGATG
TCGAGGAGTGGACAGAAGACGTCATGATCTGGACGCCGTACCCGACCGACGACGAGAACGACGGGGAGACGAGGCGGCGT
CAAGCAACGGAGCATCCACGGCAGCAGGAGGCAAGGCAAAGACGCATAGCGCGGTGATTGATGAGGAGACTTTCCTGCTG
CCCAACTCGGCCGTGCTCTGCCTGGAGGGAATGTCACACTATATGCATCTCATGGTGGCCATTCCTTTCATGACGCTCGA
CGTAGCCTTGTCACTGGTGCAATACCTACAGCTGTTCAACTCGCGTTGCACGCAGCTGATCTTGGGCGCCGGAGCCACAC
GGTCCGCGGGTCTGAAGAACATCACCACACGACACCTGGCGGTTGCATCGCAGTCGCTGGCCTTCATTGCCACGGTCATA
CCCTACGTCCGAGAGTTTGTGCGGCGCCGTGCCGGCTCGAGCAGCAGCAGCAACGGCAGTACTGCACAAAACGTCATGGG
TGAGTTTGACAAGGTGCGGCGGCTCTACCAGGAGCACCAGAACAGCATATACGACAAGCTGGTGGAGATCATGGGGGGAC
GCGCGCAGGCGCATGCCAGGACCATGCGTAGCATTGACTGGGACGCATCTGCCCCCAATAGCACAACGGTGCATGCATAT
ATGGATACGCTTGTCAAGGAGACCACCACTCTGCACCGCAACCTGGCCAAGACGCTTCCTGAGGGAACGGTACGATTCAT
CATGACGTCTGTGTTTGCCGAGTATAAGGAGCAGCTGGGTGGTGTGCTCCGGGGATCAGATGTCAAGACGGCAGCAGGCC
GCGACAGGTAAGATACGATCTCTAGAGACAGCCCAGCGAAGTACTTTCAGAGAGCTAACCTACAAACTCAGCATGCTACA
TGATGTAGAAAGCTTACAGACGCGCCTGGGCAAGCTTGACGGGTTTGGCGATGTCGGCAGCTTCCTCAAAGAGATCATTG
AAAGCAAGAAGATCAAGGTTCCCAGTCCACCTCCAAAGCTACCAGCGAAGGAGCCAGAGCCAAAGCCAGTCGCAGCGAGC
GAGGTGAAAGAGGGGAAGAAAGAGGAGCCCGGGGAACCCAGAGATCCCAAGGAGCTCGAAGAGGAGAAGAAAGAAGACGG
ATCCCAAGCGAAGGCGTCTTCGACGCGGGACGGATATCTTCAGCCTCCGTCAGCTCCGCCGAAAGACGTTAAGACGGCCG
TTGGCATGGTTGCCACGAGCGATGCGGCCAAGGCAGCGGAAGAGCCATCCGCAGACAGCACAAATGGTGAAACCAACAAT
AATAATAACGGTGATGAGGTCCGTCAAACAAGCGAAAGCATGTCAGAGGAACAGAGGAAGAGCGAGGACAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62