GenePrediction:GLEAN_1755 Details

Name: GLEAN_1755
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:941995..944711 (+ strand)
Length: 2717
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:941995..942031 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_144:942173..943127 (+ strand)
Length: 955
Type: CDS
Source: GLEAN
Position: GCSC_144:943469..943492 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_144:943645..943793 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_144:943852..944711 (+ strand)
Length: 860
>GLEAN_1755 class=GenePrediction position=GCSC_144:941995..944711 (+ strand)
ATGTCGGACGGCAAGCGGGCAGTCGACTCAGACAAAGGTATGGGACGAACAAGCAGGGAGCCGAAGTGTGGAAACCTAAA
GAGAACACGCAGAAGAGCCTATGTGATAGGAAGAGGAGATTCAGAAGATGGTTGAGCAAGAGGCTGAACTAACGCACCCC
CCCTCCACCTGTGTGTAGTCTGGACGACGCTCATCACCAACCTAGCCTATCTTCCCGGGCTGCTGACGCTGGACCACACT
CTCCGGCGCGTGGGCTCAGCATACCCACTGGTAGCGCTCTACACGGACACGTTTCCCGAAGAGGGTCGGACGGCGCTCGC
GGCCCGCGGCATAGCGGCACAGCGCATCGCGTACCTGCTGCCGACCAAGTCGTCGCGCGACTACAGCGCAGACCCGCGCT
TCTACGACTGCTGGAGCAAGCTGACGCCCTTTGGGCTGACACAGTACAGCCGCGTGGTTCAGCTGGACAGCGACATGTTG
ATGCTGCGCAACATGGACGAGCTGATGGAGCTGCCGCTAGATGCGCCCGACATGGCGGCGCAGGTGCCGCCGCACCCGGA
CAGCAAGCGCGTGTTCGCGGCCGGCCACGCCTGTGTATGCAATCCCCTGGCCAAGGCACACTATCCGGCCGACTGGGTGC
CGGCCAATTGCGCCTTCACGCTGCAACATGCTGACGCCGACCGGGCGCAGCGCGAGGGCGCTGATCCGACCGAGGCCGAG
GCTTCTATCGGCGTGCACCTCGTCAACGGCGGACTGCAGGTGGTCAACCCGTCGCGGGACATCTTTGAGCAGATTGTCGC
CTATATGGACGACAATGCGGCCGACCTCGCGTTTGCCGACCAGAGCGTGCTGTCGGAGCTGTTCCGCGGCCGCTGGGTGG
CCCTGCCCTACATCTACAACGCGCTCAAGACGCTGCGCTGGCCCGGCGTCCATGACGCGCTCTGGCGCGACGACGAGGTC
AAGAACGTCCACTACATCCTGACGCCAAACCCGTGGGACGAGCTCGACGCCGAGGGCAACCTGCGCGAGGGCGTCCAGCG
CGACCCCCGCAACGAGATCACCCACAGCTGGTGGGCTGATGCCTGCCGGGAGCGAAGGGAGGCCGAGCGGGCCCGGGGGA
TCGCTGACCAGTGGTAAGCTGGATGGCATGGCTTTGAGGGCAGCACGGAAGCATGGTATGGTTGGTAGACAAAAGGACAA
GACAGGTCGGCTGACGCGGAAATTGGCTTCTTGCATTACTGCGATATGCCCGCTGCGAAACAAAACAAAATAGCGGATGA
AGAGGTCTTGACTAGATGTAGCGGTCAATCGGTAAAACATATGTCTTGAAGCGATCGATCGGCTCGATGCTGCGAGTAAA
GCCGTGGCAAGCAGCCCCCGCGTTGGGATTAGCGTTCGCCCCGGGGATTCTAGCGGAACCCCGGCCAGCCACTGCAGCAA
TCACGGGACCACTACTAACACTGGAGAAAATAAGGAAAACGGCAACCGGCACCGGCAAGTGCGCTTCTCACTGCTCCTTC
CGTATTTTCTCCATACTGTTGCAAGTTTCTGTATTTGGGGTGAATATCGGGGGAAGCGGCTTTTTGTCTTGTCAGTCCGA
CCGTGTCCTCATGGCATAGCACGCCGCCATACCGACAGACAGCCGCCCAGACCCCTTTACCAACCCGCCATGGCCGCGAC
GCTTGGGACCGTGAAGACGGCGGCAGCATCGACGACTGCGCCGACTGCTGCCTCTGAGAGTTCCAGCCACTACAGGGGCT
TCGTAGCTGGCATCTTCTCCGGAGTGACCAAGCTTGTGGGTAAGAAGACATGAGAGAAGCCTTCCTCGGCGGCCACCGGT
CTCGCTGACACGCCCAGTCGGCCACCCGTTCGACACGATCAAGGTGCGCATGCAGACAACCTCGGCCGACCGCTTCGCCG
GTCCGCTGGCCTGTCTCGTCAGCACGGTCCGCAACGAGGGCGTGCGAGCGCTCTACAAGGGTGCCACGCCGCCGCTCGTC
GGCTGGATGTTCATGGACAGCGTCATGCTCGGCAGCCTGACCGTCTACAAGAAGCTGCTGGGTCGGCACTGGTTCGGCCT
GGATGAGGCGACATCGCACGGTGGCGCCACTGCTGCGGCTGGTGGACCGGCACTGCCGTCGTATGGCCACGGCATCGCCG
GCATCGGCGCCGGTCTCACCGTCAGCTTCGTGGCCGCCCCCTTTGAGCACATCAAGGCCCGTCTGCAGGTGCAATATGCC
GCCAGCAAGGCTGAGCGGCTCTACCACGGCCCCGTCGACTGCCTCGCCAAGGTCTATCGCCATCACGGCCTTCGCGGCGT
CTATCGCGGCCTCGGCTCCACCATGCTCTTCCGCTCCAACTTCTTCTTCTGGTGGGGCAGCTACGACGTCTTCTCGCGCC
AGCTGCGCCAGCACTGGCCTGCCATGCCCGCTGCCCTCGTCAATTTCTGGGCTGGCGGCCTGAGCGCTCAGGTCTTCTGG
ATCGTCGCCTACCCCAGCGACGTCGTCAAGCAACGCATCATGACTGATCCCCTTGGCGGCGGCCTCCACGACGGCTCCCC
GCGCTTTCCCCGCTGGCGCGACGCCGCCCGCGCCGTCTATCGCGAGTCCGGCGTCCGTGGCTTCTTCCGCGGCTTCGTCC
CCAGCTTCCTGCGCGCGTTCCCGGCCAACGCTATGGCGCTCGTCGCTTTCGAGGCTGCCATGCGGACACTGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62