GenePrediction:GLEAN_1756 Details

Name: GLEAN_1756
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:947060..947361 (+ strand)
Length: 302
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:947060..947076 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_144:947136..947242 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_144:947312..947361 (+ strand)
Length: 50
>GLEAN_1756 class=GenePrediction position=GCSC_144:947060..947361 (+ strand)
ATGGCTGTTACCGGAAGGTTCGTTTTCTCTCCACCGCTTATTGCTCTCACACAGACCCATACTGATTGTTTCTCAGCGAC
ATCTGCAAGATCATCCTTGCCATCATCCTACCACCTCTGGGCGTCTTCTTGGAGCGTGGATGCGGTGCCGACTTACTCAT
CAACATTCTATTGACCATTCTAGGTGCGTGTTCCCCGACCGTGGCGTCTTTTTTCCCTTATGAAACGGGTTATTAGCTAA
CAACAAACACAGGCTACCTACCCGGTATCATCCATGCGCTTTACATCATCCTCAAGTATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62