GenePrediction:GLEAN_1757 Details

Name: GLEAN_1757
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:950241..952265 (+ strand)
Length: 2025
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:950241..950702 (+ strand)
Length: 462
Type: CDS
Source: GLEAN
Position: GCSC_144:950750..951790 (+ strand)
Length: 1041
Type: CDS
Source: GLEAN
Position: GCSC_144:952116..952265 (+ strand)
Length: 150
>GLEAN_1757 class=GenePrediction position=GCSC_144:950241..952265 (+ strand)
ATGGCAGCCGCCTTTACGCACCTGCCCATATCTTCTCTTCCCGTCTGGCAGACCCTCAATGATGTTTCTTTTGTCGACAC
TCGCATCGCCGAAATCCCTGGGAAAGGTTATGGCCTTGTGGCCAATCGCAGTCTTACCACTGCAAAACCGACCTTTCACC
GGTCCTCGCTCGTGTCCGTCCCGCACAACCTGATCCTGAACGCAGAGACCGTCGAACAATATGCCAAGCAGGACCGGAAC
TTTCGTCAGCTACTCGAAGTTGTCGGCCGCCAGAGCGAGAGAGGCGATGTGTTGCTCTTTCTTCTGGTGCAGGTGGTCCT
AGGACTGAAGCCACCCGGGACCGACTCTGTAGCATTGCCGACCATCTGGACCGAATACGTCAAGTTCCTGCCCGCTGACA
TCCCACTGCCAACGATGTGGTCAGACACTGAGCGCCTCCTTCTGCAGGGGACATCTCTCGAGGTAGGCTCTTTGCTGCGG
GTGCCTCTTCCTTCTTTCTAACTCGGCAGGCTGCTGTACAAGCCAAAAGGATCGCTCTGGAATACGAGTTTGACCAGCTA
CACGAAAAGTCTTCCGATATTCCCTACTGGCAGGCAGCATTCTGGGACGACGAACGTGCTGGTACTGGCCCTCAGCTGCA
TCACTGGTTCCTCGTCGACGCATGGTATCGCTCCCGCTGCCTCGAACTGCCTCAATCTGGTCCAGCCATGGTGCCTTGCA
TCGATCTGGTCAACCACGGTTCCGCCCCGAACGCATACTACGAAGAGAACGAGATGGGTGGCGGGGCGCATGGTGGCGAG
ATTTCGCTTCTGCTACGACCGCAGCAAAGCGTGGCGGCATCCGACGAAATCACCATCTCTTACAGTGGCGGAGACGGAGA
CGGTGACGGCGACGACGACCATTGCGATACAAGGAAGCCAGCATCCGAAATGCTTTTCAGCTACGGATTTGTCGACCCTC
ATTCGATCCGCCAATGTGTCATCCTTCCCTACCGACCGCTACCCGACGACCCCTTGGCCAAGGCCAAACTGCATGTCTTT
GGCTCACCTGGTCCACGCCTGGAGATAGAGCGATTTGGTGCTGCCACTGATGACGACGACGACGACGACGACAATGACGG
CTGCAAGAAAGTCACACCAAACGTCCGCTGGACGTGTCCTTTTGCGTACCTAGCTTGTGTGAACGAGGAGGACGGCTTGG
CTTTTCAGCTACGTGCAGAGACAGATGGTACACAACAGCTCCGAGCGTTTTGGCAAGAGGAAGACGTGACTGAAAAGGGA
CGCGATTTCGAGTCTCTGACGAAAGCTCACCCTCTAAGCGCCGTGTTCCAGCTGCGCGTTGTGACGATGTTGGAAGAGGT
GCTGGAGGCTCAACTAGACGAAATGCAAAGCGCAGCAGCCGACGACACCCCGATCCGAGCACTGCAACAACAGCAACAGC
AGCTCTCCGACAACTTTACAGCTCGGCCAGATGTGGCCAAGCAGGCTGGCTTGCTGAGGGACATTGAGTCACGCGTGATC
AGTAGTGTTCTAGAAGCACTTGAGACTGAGGTGAGTGGACTGATTTGCTTTCTGAATTGCCCCGTTTCCCCATGCCTGTC
CCCATCTTCCCCATTGTCTCTGCTCCATGCTCCATACTCGATGGTTCCGGGATTTCCCTCGCCTTGCGTTGCAGCATCCT
TAACCCATTGCATCTAAGTCTGGTACCCGGGGTGTGGGTTTCGGTTACAATGGCCACTCTTGCTCGGGGAATTATGGATG
CTCGTTGGTTGGTGGAAACGAGGCTGGGGTGCATGAGGCCAATCTACCGCTTCTTACTCCGTACTACTCTATATCAGAGA
CAAAACGGATGACGACCACTAACCGGCATTTGCAGAGATCAAAGCTGCTCACAGATACTAGCGTCCTAGCTTACCTCGGG
TCGATGGATATTGCCGAAAACGACTTAGCCGATGAAGAGGCGTCCAATCAGAAGCCGTCGGATGAGATGGCGGATGGAGA
GGATGCAGACGATGACTTTAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62