GenePrediction:GLEAN_1758 Details

Name: GLEAN_1758
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:956657..959809 (+ strand)
Length: 3153
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:956657..956896 (+ strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_144:956965..957151 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_144:957219..957365 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_144:957423..958351 (+ strand)
Length: 929
Type: CDS
Source: GLEAN
Position: GCSC_144:958445..959809 (+ strand)
Length: 1365
>GLEAN_1758 class=GenePrediction position=GCSC_144:956657..959809 (+ strand)
ATGCCGGGCATACTACCTATGAAGGTCATTAAGGTGGGCACCAGCTCACAAAGCCGGATTGCCCAGGCCTGTGACCGTTG
TCGCAGCAAGAAAATCCGCTGCGATGGCATCCGGCCTTGCTGCTCACAATGCGCCAACGTCGGGTTTGAGTGCCGCACCA
GCGACAAGCTGAGTCGGCGCGCATTTCCTCGCGGCTACACCGAATCGCTAGAGGAACGCGTGCGCCAGCTCGAGTGTGAG
GTGCGCGAGCTCAAGGACCTGCTTGACGAAAAAGACGAGAAGATCGACATGTTATCAAAAATGCACAGCAACCATCGCCA
TTCTTCACTCGCTTCACAGATGCCTCCTTCGCCCGCAACTGCTTCGGTGGCATCTCCCTCTGCCTCGTCCGCTACCAATA
CCACAGCCTCCGACAATGGTTCAAATCAGTCCTCGGCTTCTTCTTCTTCTCCTTCTTCCTTATCGCCAGGACCCTTGGTG
TCAACAGCAGCAACTGTAAAGCCTGAAAAGGGGACGGCTGCAAGAAGATCTACATGTGACACAATAATGACAACGTCGGC
AGCACAAAGATTAAAGAGAGACTCGAGATCACCCACTGCTCCGCCATATGCAGAGGACACATTCCGCGTGCAGGCGTCGC
CGTTGTTATTGGGTGTTGAAAACTCAGACTCCTACTTTATGGGTGCATCGAGCGGCCGTTCTTTCATCGGTGCGTGTCCT
CTTCACATTACCGCTCCGCCGTGTTCTTTTACTAACCACCTTACAGAAACATTCAAACGAAAATTGCAGGAAAGTGGGAA
GTCGTGTTCTGACTTCCATTCTGAGGCATTCCTTCACATTCAGGGCTGTTACCCCCTTGTCGAAAATGCTGCATCCCTGC
CATTACGGGTGCCACCGCGCATGTTCACAGACCGTTGTGTCAACGTCTACTTCCAAGAATGGTCACCACTGTTCCCCATT
CTGCACCGCCCTGCCTTTCTGCGCATCTACGATGACTTCGTCAGCGACCCCGACAAGGTCAAGAACCACCACAAGCTGGC
GCAGCTTTATCTCGTTTTTGCCATTGCAGCCCTTTCCAGTGATCAGCCTGATCTCGAACAAGTTGCGATTTGCGAGCGAC
AATGGCAGCGGTCGCTGGAGGCTGTGCTTATGGACAACACCATCATCACCCTCCAGTGCCTTGTTCTTGCCCTTCTGTAC
TGTACTGCGCGCGCCGATTACAAGCGCTTGCAGTACTACAAAGGAATTGCTGTCAGCCTGTCTCATCGTCTCGGCCTGCA
CCAGAGCCAAAAGCGGTTTTCTTTTGGCGCACTGACCATTGAGACCCGCAAGAAGGTCTTCTGGACTCTGTACACGTTGG
ATTGCTTTTCGGCCGCCGTCCTGGGCTTGCCGAAGCTGCTGAAGGACGACGATATCCACACGGAATACCCCACGGACACT
GATGATGAGTATGTTACGGAGAAGGGCTTCCAGCCGACATTGCCCGGCGAGTCCACCCGCGTGTCGGCTGCCCTCGCTCT
CTTCCGCGTCTCTCGCATCCTTGCCAAGGTATTGGAGACAAATTACCCGGCTGCTGCAACGCATGAGCTGTCGCTTCAGC
AGATGAGTGCTCTCGAGACCGAGCTGATGGAGTGGCGTGACGCTCTGCCAAAGCATCTGGCGCTTACCTTCCGCCAAGAG
AAACCCTCTACTGATGTGACAGGGAACAGATCTCCGTTGCTGGGTTTAGTCCCAATCTGCCCTCCATCCTTAGTGCCGTA
CAATAATACTAACATGGAATTTTTTTAGTCCCTTACCTACTACTATATCCGCACTCTGATCTGGCGCCCGGCCGTCGGGT
CCTCTCTGGGTTCAAAGGCAGGGTCTGCTCTGATGGCAATCAGTGAATCCAGCAAGCACATAGTACAGATTGTGGAGCTA
TTGGAGGAGCGAAAGATGTCCTTTTCTCTGTGCATGAACGAGCCGGATATTCTCATCATTTGCGGCATGACATTGCTGTA
TCAGAGCATGAGTCTGAAACCGGACAGCAAGATTTTGAAGGATAGCGAGCGGCTCATCAACGCGGCGATCAAGATTGCGG
ACCGTACAAAGGCCCCTGGTTGCTATGACTTCAAGCGTGTGGCTGCCATGATTGTGAGCGTGGACGACCTGCCAGCACCC
GTTCCCAGCGTTTCGCGCCCCAGCTCGGAGTCGGCCGCGACAGCCCCGACACGGCGTGCGTCTCAGTCCGGAAGTCAGCA
GAGGAAAGTGAAGCATATTCTTGGCAGACACAACAGCGCCAGTGTAAGCGAGACGGACTTGCTTTTGCAGCAGGAAAAGC
TTCGGCGTATGACGATGCCGACATCCACGACTATGACTGCGGGTTCTCTGGGCATCAAGGCCGAGCCGAGCCCGCGCTCT
CGGTCCTCGTTCGATGGCTCTCGTGACCAGCGCCCACAGCACCGGCTGTCGCTGTCTCAGGCACAGATGCTCAGCCGCTT
TTCCCAGCTACAGCAACAACAGCAACAGCAGCAGCAGCAACAACAACAACAGAGAATGGCGCAGAAGAAGAACTTGGACT
ATCTTGCCATGGATGGCAGTGGAAATGATGGGGACCAGTCGCCGTCCTCGCCAGCGCAGCCAAGGAACGCTCAGCACCAG
CCACACCAGCAGATGTATTACGCAAGCCACAAACCAGCGTCTATGGCCGGCGTGACCCCTGCAGACTGGGAGGCGTTATT
GGGCTCGATGGACGGCGGACACATGAACGTGTACGATGCCATCTACGGCGGCCCAGCGATCGGGCTGGCGCAAGGCTCGG
AGCAGGCGCAGGCGCAGGCGCAGGCACCAGCATCTGCAACGTCACAATCGGGCGACGGCTGGTCGCCTGAGTCCTGGGAC
CTGTCTGGGTTTACGCTTGCCGACTTGGGACCCGGTTCACACAGCAGTGGTCCGGGCAGTGTGCCGCCACCGGCCCAGAG
CGTGCTGAGCTTTAGCGATGAGAGCCTGAGTGGTGATGATCTAGCGTCGACGGATCTAGCCAGTCTTGGTCTCAGCGGCC
TGGATCTGGGCAACCTCAACTACCGGAACGGAAACCACATGTTGAACAACAACTGCGCACCACAGACGGAAGCATTTGTC
ATCGACGGCATGGAGGCCGATTTTGTGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62