GenePrediction:GLEAN_175 Details

Name: GLEAN_175
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1175750..1176278 (+ strand)
Length: 529
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1175750..1176145 (+ strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_179:1176204..1176278 (+ strand)
Length: 75
>GLEAN_175 class=GenePrediction position=GCSC_179:1175750..1176278 (+ strand)
ATGACCCTTCACCATGACAGACACCACCAGGCTTATATAACAAACCTCAATGCGGTCCTGGCCGACTACTACGTTGCTGC
CTCTCAAGGCCACATTGCCGATCAAACTGCCCTACAAGCGTCTATCCACTTCAATGGGGGTGGTCACATAAATCACGCCC
TTTTCTGGCCGACGCTTGCTCCTGCCAGCAGTGCTGATGCCTGTGAGCCCGAAGCGAAGGCCCCGAGACTCCTGGCTGCT
CTCGGTGTCGAATATGGCAGCCTGGACAATTTCAGCACTACCTTCTCGTCGACTCTATTATCCGTCCAGGGATCCGGTTG
GGGCTGGCTTGTGCGCTCTGGATGCGGTGTCGATGGACGCCTGCTCATCACTACAACTAAGGACCAGGATCCGGTTGTGA
GTGATACGCCTATATTAGGCATCGACATGTGGGGAACATGCTTACTACCTTTAGGTAAGAAGTATTGCAATCGGTGGTCA
GGCTTCACTACAGAACCCACAGACAAGGAAGGCCCTTTGTCCGTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62