GenePrediction:GLEAN_1760 Details

Name: GLEAN_1760
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:966838..968234 (+ strand)
Length: 1397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:966838..966906 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_144:966958..967085 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_144:967459..967548 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_144:967598..967946 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_144:967995..968234 (+ strand)
Length: 240
>GLEAN_1760 class=GenePrediction position=GCSC_144:966838..968234 (+ strand)
ATGACAGAGACCACATCCGTAGTCGAGGTTCATCCGGGGCATTACTGGACTGCACAGCCCCTGGGCGATGTGAGGTATAA
TCTGACAGTTCCACATGTGCTGCTCTAACCATTCGCTAAGGAGGATGACTCAACTCGCGGCGACGACGCGTCCACATCTA
CTGCGTCCATCGCCTCGTCAATCTTGCACTACCGGACCGTAAATGGACGAACTTATCACAGCGATGCCGTTACAGAAACG
AAGTACTGGTAGGTTAACAGCGTGAACTTTTCCACCTCGAAGTTAAAGACCCCAAGCTAAAAATGGCAGGGGCGCAAATG
ACGAAGCTCAAATCAAAGCGCTAGACATCGAGTAATAAAGACACGATCCTGTAAGGTTGAGTACTTGTGATAACACCAGT
TTAGGCACCATACGTTTACATTAATGCTAGACGGGAAGCTCCATCTTGCACCCTTATCAGCCGATATCAAGGTAAGTCGT
ATGTGTACATCATGCGTTTTGTTTATGGGACTTACGTGTTACTAGAAAGTAATAGATATTGGGACTGGAACGGGAGCTTG
GGCTATGTAGGTAGTAGACACCTTCGTCGACTTCTGACTAGCAGCTAATACGCCGGCTTAGTGACTTTGCCGACTTACAC
CCTAACGTTACAGTGATCGGCACTGACATATCCCCCATTCAGCCGGCGTGGGTGCCGCCTAACGTGAAATTGTAAGATTT
AAGCTATTAGGAGTACGAAGTATAACCTGACATGGCATAGCCAGATCGATGACTTTACACAGCCGTGGACTTTTGCGGAG
GAATCAGTCGACTTCATCTACGCACGGTGGCTAATCGGCTGCGTGACGAACTGGACAGCTCTGTTCAAGGAGGCATACCG
AACCCTGAAGCCAGGCGGCTGGATTGAAACATTCGAGAGTGACGGATTCTTCGAGTCCGACGACGGCACTCTAACCGACA
AGAACGCCTCTAGCCAATGGGGTCACATCTTTAGTGAGGCCACCAAAAAACACGGCTCGACCGCTTCCTTCACAGTAGTT
CGTGACAAGGTGCAGCAGAAAAGCTTAAGAGAAGCGGGTTTCGTCAACATCCAAGAGAACCCAATCAAGGTCTATTTCTC
TCCTTCTTCTCGTCTTACTCATCTAACTCCAAAGTAGTGCCCTTTTTCCGAATGGCCAGAAGACCTGAAACTGAAGGAGA
TTGGCCTGTTTACTCGAGCTGCCTGGGAAGCTGATCCCGAGGGCTTTATAGGCTACATGGCGCACTCGCTTGGCTGGACA
AAGGAGGAGATCACCGTATACTGTGCTCACATGCGCCGCGAATTGCGTGGTCTGAAGATTCATCTGTTTTATAGAGTGAA
TGCGGTATGGGCCCAAAAGCCTTTTTCTCCTAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62