GenePrediction:GLEAN_1761 Details

Name: GLEAN_1761
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:973696..975205 (+ strand)
Length: 1510
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:973696..973719 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_144:973778..973854 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_144:973924..975205 (+ strand)
Length: 1282
>GLEAN_1761 class=GenePrediction position=GCSC_144:973696..975205 (+ strand)
ATGTCGGACAGAATCCCTGCCATTGTGAGGACACGATACTTGTTTGCAGGGCTCAGTGGGCCTCATCGCTAACCGGTCTC
AGTGCCGCGACCGCGTGTCGGAGCGGGCGAAGAAGACGCTGGACATTGTGGCCAAATTTGTGGAGGAGGAATGCATTCCG
TGAGTGTCTAAGGGCAACGAGGCGTGGCTCGGGCAGATGACTGATGTCCTCTCTCTCTCCTTCACCAGGGCCGATCCGGT
CGTGGAGGCACAGACGGGCAAGGGTGAAGAGCGATGGGAGCAGCACTCGACGATCGTGGAGGAGCTCAAGACCAAGGCGC
GGGCGCTGGGGCTATGGAACATGTTTCTGCCGGCGGGCCACTACAAGGAGTCACCGGGGTTCACGAACCTGGAGTACGGG
CTGATGGCGGAGTGGCTAGGGCGATCGCGGGTGGCGTCGGAGGCATGCAACTGTGCGGCGCCAGACACGGGCAACATGGA
GGTGCTGGCCAAGTACGGCAGCGAAGCGCAGAAGGCGCAGTGGCTGGTGCCGCTGATGGAGGGCCGGATCCGGTCGGCCT
TTCTGATGACGGAGCCGCAGGTGGCCTCATCGGACGCGCGCAACATTGAGATGGCGATCCGGCGGGAGGGCGATGAGTAC
GTGCTGAGCGGGTCGAAGTGGTGGTCGAGCGGAGCGGGTGATCCGCGCTGTGCGCTGTACATTGTGATGGGACGAATCGA
AGGGGCGGGATCGACGGCGGCGGAAAACCCGTACGGCCAGCAGTCAATCGTGCTGGTGCCAGCGAACGCAGCGGGGATCA
CGATCCGGCGGATGATGAGCGTGTACGGCTACGACGACGCGCCCCACGGACACGGACATCTGGTGTTTGACGGCGTGCGG
GTGCCGGCGGCGACGAGTCTCGTGCTGGGCGAGGGCCGCGGCTTCGAGATCATTCAGGGACGTCTGGGACCAGGACGGAT
TCACCACGCGATGCGGGCAGTCGGAGCGGCCGAGCGGGCACTGGACTGGCTGCTGATGCGGATCAACGACCCGCGCAAGA
CGCCGTTTGGCAAGCTGCTGCGCGAGCACGGCGTGGTGCTCGAGTGGGTGGCGCGGTCGCGCATCGAGATTGACGCGGCA
CGGCTGGTGGTGCTCGGGGCGGCCGTCACGATGGATGAGCAGGGCCCCAAGGCAGCCCTGACGCAGATCGCCGAGGCCAA
GGTGCTGGTGCCGGCCATGGCGCTGGCCGTCATCGACCGGGCTGTGCAGGCGTTTGGCGGCGCCGGTGTCAGCCAGGACA
CGCCGCTGGCGGCCATGTGGGCCAACATCCGCACGCTGCGGCTGGCCGATGGCCCCGATGAGGTGCACCTGCAGCAGCTC
GGCCGCAACGAGAACAAGCGGCGCGGCGCCGCCGTGACGGCCTCGATTGAGAGCCAGCGCGCCCGCAGCGAGGAGCTGCT
CGCTCGCCACGGACAGACACGTGCGCAACCGGGCGAAAACATCAAGCACGCAGGCAAGTCGAAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62