GenePrediction:GLEAN_1763 Details

Name: GLEAN_1763
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:982248..987587 (+ strand)
Length: 5340
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:982248..982445 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_144:982499..984802 (+ strand)
Length: 2304
Type: CDS
Source: GLEAN
Position: GCSC_144:984864..985208 (+ strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_144:985258..986697 (+ strand)
Length: 1440
Type: CDS
Source: GLEAN
Position: GCSC_144:986748..987587 (+ strand)
Length: 840
>GLEAN_1763 class=GenePrediction position=GCSC_144:982248..987587 (+ strand)
ATGGCCGGCAAAAAGCCCGTGAAAGCAAACGTCAAGCAAGATGACTCCACCAACTTTCCCGGCCTGCAGCAGCAGCAGCA
GCAGCCGGGAAGTGTGAAGACTGCGTATGAGGAGCGCCAGGAAGAAGAGCTGACCGCCCTAGAGGCCATTTACGGAGACG
ACTTTGTCCAACACAAGGCTGCGCACAGTGCTTGGAAGGTATGCAGTCATCTGTCTCTTTGATCCGAGCCAATGTCTTCT
GACAAGCAAAGAAATCAGAACCGTCCTTCGATATCCGGATCAGGGCGCCCTCAGATGAAGACGTCGCTTTGACTTTGGGT
GTTGTGTTGACCGCAACGTACCCCAAATCAGTACCGTTGCTTACGCTCAAAGACCGCGATGGCCTGCGGGATTCGACCGT
GTTCAAAGCACAGAAATATCTCGAGAAGAACGCCAAAGAACATGCCGCCGAGGACACGGTTATGATATATCTGCTTGTGG
AGGGGATCCGCGAGATATTGGAAGATGCAGCCATCGCCAAGGCACAAGGCCTGGAGCTGCCCTCCTTGGAGGAAGAACGA
GCAGCCCACGAAGCTAAGATCGCGCAGGCTGCTCTGGACGAAAAGCAGCAGGAGGACCGAAAGCGCCAGGAAGAGGCGCT
GGAGGAGGAGCGTGCTCTCGGAGCCCTGGTGGAACAGGAACGCGAGCGCCAGCGCACCAAGGCCAAGGAGCTGCGGAAGA
AGAACAGGAGCCACATTGGCAGCACCAAGTCTCCCGAGCGTGCTTTTGGTTCCGAAGCTCCCGACGAAGCCATGGTATTC
GACGAGCCGTGTGAAATGGTGGACACGACCGGAAACACCGTCCAGTTCAAGGCCGTGACTGGTCGATTCCTCATGCATAC
GGGACCCATATCGAAGATCTATCTCGTGAAACCTATACTTCCGGGCGACCAGGACGAGTGCAGCCTGGCGCTCAAACAAA
CAGAGCTGCAGACAAGCGCCAACGACTCGGTGGCAGTCCTGAAGCAGATGCAGTCTCTAGAGACCCAGCTGATCGCTCTG
AAACGGCTGCGTCGCCAGAAAGTGCACCGCAACATTGTCGACGTGATCGACTTTCGAATTGACCGGGCGTCTGGCATGCA
AAGTGTGCAAAGTGATGAGTCACCTGGACAGCCCCAGCCGCCTCCGACCTCGCCCACGCGTACCAAACGGCCCAAGTCTC
CTCGGCTAAGCCAGTCCCAAGGCTCGCTCACCCAGCCCCTGCAGCCGCAAGAGCAGACGACATGGACTGTCAGCATTCTG
AGCTTGATGTCGGACAAGGGATCGCTCGAAGATATATTGGAGCTTGCTGGACACCTGGAAGTGACAAAGGTGCGGGCTTG
GACCCGGGACCTCCTGGATGCTCTCGACTTTCTGCACGGTCACGGCCTCCTCCACGAGGATCTTCACCCAAGCAATGTGC
TGCTCTGTCGGGATGCCACCAGTGACATCATCCCGAAGCTTGCCGACGCCTCTTACCAGCAGCTGATGCACAGCATCTAC
TCGCGCAGTGGTCCCACGATCGCATCCACACGCACAGCCCGATCTGCCTACTGGTTGCCGCCCGAGATTGCTGGAGCATC
GCGGCCGACGTACACACAGAAAACAGATGTCTGGGATTTCGGCCTCATATTTCTGCAGATGGTCTTCGGCCTCGATGTCC
CTCAAAAATACCATTCCCCCAAGGACATTATGGATTCGCTCAACTTGTCCGACCCCCTGGCCGAACTGGTGTCCAAGCTG
TTTATGCCGGATCCCAAGAAGCGGCCACGAGCCTTTGACCTCGGCTCCAGCGAGTTCCTGGCCACGGATGCACCGATTTT
GTCTGAGGACACGTTCGCAGTGGACGACGCCATGATCTCGATCCCTCAGAGCCTTCCGACCCGGTTCCGGCGCGACTCGA
CAACGCGGGTGCCGAAAGCGTCTCGTTACCGTGAAGATTTTATCGAAGAAGGCCGCCTTGGAAAAGGCGGTTTCGGAGAG
GTTGTGAAGGCGAGAAAGAAGCTGGACGGGCAGATCTACGCCATCAAAAAGATTACAATCACACAGAGCTCCGGAGACAG
CCTCACGGTTACCGACATTCTGAAGGAGGTCCGGCTTCTGTCCCAGCTCAGCCACCCGGCCGTTGTGCGATACTACAACG
CATGGCTGGAGGAGATACATGATTTTTCCGGCTCGGAAGGTGAAACAGCCACAGAGGGCTACAGTTCTAGAGAGAGGGAG
GATCTGGAAGGCTTTAATATCGAGTTTACGAAAAGCGGTGGCTTGGACTTTCTGTCTTCTGGGCCGTATCCCAACATCGT
GTTCGGGTCCGATTCGGATGAGGAGGGGGGCAATTTTAATGCCACGGACGAAGACAGCAGCGAAGAAGAAGAGGAAGACG
AGGTTGGCAGCTCCGACGACGACGCTTCGAATACTACGGAGACCAACGACGGAAACAATCGGATGCCTGCTCGTGGCTGG
TCGCGCACCAGAAGGGGCAGTCAACGGCCGAGTCGTACGATCATGTACATCTCCATGGAGTACTGCGAGAAGCGGGTAAG
TGTCTCTAAATGGGTAATCATTCCTAGTATTTGGTGGGCTAACAGCATATTCGCAGTCTCTTCGGGACCTCATCGCACGA
AATCTATCAAAGGACACGCAAGAGGTATGGCGACTGTTCCGACAGCTTCTCGAAGGTCTGACACACATCCATGGACTGGG
AATCGTGCACCGTGACCTGAAGCCAGACAACATCTTTATCGGATCTGGAGCCGATGGCGTGAACAATGCCAAGATTGGAG
ACTTTGGGCTCGCTACGACGGGCCAGCTTACTGCGGCCGACAAAGCGTTGACGTCTGGAACGATGGATGCGACTGACGAA
ACGAGAAGCATTGGCACGTCGGTGTATGTTGCACCAGAGGTTCGATCGGGAGGCAGCGGGTCTTACACGACCAAGGTTGA
CGTGAGTTGTTCCGTGTTGGCTGGTTGCCCGCGCTTTACTGACAGGCCAGATGTACTCACTCGGCGTGATCTTCTTTGAG
ATGTGCTACCCGCCGATGATTGGGATGCAGCGTGCAGACGTGCTCACGAAGCTCCGAGGGTCTCCTCCTGTGCTGCCGGC
AGACTTTAAGCCCAAGGAAAAGTCGCAGGTAGACATCATCCAGTCACTTCTGACGCACAACCCAAAGGAACGACCGTCGG
GAGCAGAGCTTCTCAAGAGCGGAAAGCTGCCGGTGCAGATGGAGAGCGAGACGATTCGACACGCGCTGGCCGAGTTGTCG
GACCCGACGTCGCCGTACTACCAGAAGATGCTGTCGATGCTGTTTGCACGGCCGGTCGAGCAGGCGAAAGACTATGCGTG
GGACATGTCTTCGATGCAGACAGCGCCGAGCTCGCAGGACCTGATGCGACAGTACACGGTCAAGGAGATGCTGGTGTCGG
TGTTCCGGCGACACGGTGCCGTGGAGACGACGCGCAGCTCGCTGTACCCGATGTCTTCGCTGTACGGCGGGGCCAACGTG
GTGCAGCTGCTGGACCGCAACGGAAATCTGCTGCAGCTGCCGTTCGACCTGACGATGGGTAATGCACGGGCACTGGCTCG
ATGCATCACGGGTGGCGACGTGGTTGCCAAGTCGTACACGTTTGGCAGCATCTTCCGGGAACGAGCAGGTGGCGGGCAGC
CGAGCATGTTTGGCGAGGTGGACTTTGACCTGGTGACGACACACACGCTGGATCTGGCGCTGCGCGAGGCCGAGGTGATC
AAAGTGATTGACGAGATCACGGTGGCGTTTCCGACGCTGCGGAACAGCCCTCTGTGCTTCCAGCTGGGCCATTCGGACCT
GCTGAAGCTCATCTTTGACTTCTGTGGCGTGGACAAGAAGGCAAGACGGGCAGTAGCAGACGTTCTGAGCCGACTCAACA
TCCACGGCATGACGTGGGCGAAGCTGCGAGTCGAGCTGCGGTCGCCGCTGGTGGGAGCGTCGACGACGAGCATCGACGAG
CTGCAAAAGTTTGACTTCCGCGACACACCCAGCAAGGCGTTCTCCAAGCTGAAGACGCTCTTCGTGGGCACTGACTCGTA
CGAGAGAGCGTCATCGACGCTGGCTCACATGCGCGAGGTGCACGAGTACTGCAAGCGACTGGGCGTGACCAACAAGATGT
ACGTGTGTCCACTGAACACGTGGAACGAGGCCTTCTTCTCGGGCGGGATCATGTTCTCGTGCCTGCTTGACAAGAAGGTC
AAGGACGTCTTCGCAGCGGGCGGACGGTACGACGGGCTCATCAAGGAATACCGGCCGCGGTTTGGGTCCAACATTCCAGA
CGAGCGTCATGCGGTCGGCTTCAGTCTCAACTGGGAGAAGCTGGCCCAGGCACCGCCACGGTCGAGCGGGAAGGCCTTTC
TCAAGCGGGCTGCCGAGGAGGAGGCCAACGGGGCTTTTTCAGCGAAGCGGGTAGGTTTTGGGTGTTCTTCACTGGCTTAG
GCTCTGCTGACATAATCAAGTGCGACGTCCTTGTGGCAAGCTTCGATCCAACGATCCTGCGGTCAGTCGGGGTGGAGCTG
GTGCGGACGCTGTGGGCACACGGGATCAGTGCAGAGCTTGCAGGCGACGCGCGGTCGACAGAGGAGCTGGTGTCGAAGAA
CCGGGACGAGGGTCACGCATGGATCGCGATTGTGAAGCAGGATGGCGTAGTGAAGATCCGGACGATGCCCGCGTCGGCGA
CCGGCGGTGGGGGTTTGGGCAGCGGCAGCGGCAGCGCAGCAGCGCACCGGAACAACGCACCGGACGTGGAGATGGCGCTG
TCGCAGGTGATGGCATGGCTGCGGGCAGAGATGCGGGAGCGCGAGTCGACGCGAACAGGGACGATAACGAAAGCATCGGC
GGCGGCGGCAGCGGCATCGTCCTCGCTAGAGGGCAGCTCAGTAGGCGGCAGCCACGGATTCGGACACCACGCGGCCAACG
AACACGATGGCTACGATGGCCAGGACGTGCGAGTGCTCGTAGGCCACAACAAGAGCAAGAAGTTCAACCGGCAGGCAGTC
GTGGAGCAGGCACAGGTCAACGCGGCGCGGCTGGTGCGGTCGTTTCTGGCTGGGCCGATTGCGGCGGTCGAGACGACGGA
CCAGGTGCTGACCATGATCCAGGCCACCTCGCTCTCGGATCCGGACAGCTGGCGGCGGCTGGAGCAGAACGTGAACACGG
TCGAGAAGAAGTACGTGCGCGAGGTGCAGGGCATGCTCGTGGACTGGCGGACGGCCTACGAGGTGGGCACAGGATCACGA
CATGCTTTCGTGTATAACTTCCGGACGGGGACATGTATCTACTATGATTTGGGAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62