GenePrediction:GLEAN_1764 Details

Name: GLEAN_1764
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:992933..994089 (+ strand)
Length: 1157
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:992933..993237 (+ strand)
Length: 305
Type: CDS
Source: GLEAN
Position: GCSC_144:993306..994089 (+ strand)
Length: 784
>GLEAN_1764 class=GenePrediction position=GCSC_144:992933..994089 (+ strand)
ATGGCCGCAGCCGCAGCTGCCGCCGCAGCAGCAGCCTCTGCACCGTCTATCCCGACGACGCTCCGCAGCCCACCCAGCGT
CTCGGCCTACACGTCTCTCGCCGATCATCAGTCGAGCACGCCGGCGTCCTTCTTTGACGGCCCACCGGTGCTACACTACC
ACGCCAAGAGTGCGCGCGCATACATCTCACGGGAACAGCGTGCAAAGCTGCCATGGGGCAGCGCCCCGGAGTCGGCCGGT
TCGCCGCTCGGCCTGGCCATGGGCGACACGGCTCAGCATGTGGTGGACGTCTTTGTGGGCTCTGAGTAGGTGGTCTCCGT
TACTGCTGCGTGATTCTCTTAACAAATACGCGCTTCTGACTGCCCCTCTGCAGAACTCTCTCGCTATACTGCCCTGCAGC
GGACTGCGGCCTCGCCTTGCCGTATCCCGTCATCGGTCTCCACGCGATCAAATCTGCGACCGCAGCCGACGGCCATCGCG
TGCCGACTGTGTACATGCAGTTGGAGCTGGATGTGGCTGGTGGTGGCAACGATGACGGGGGCGAGACGGTCGAGCTGAGC
CTCGTGCCGGAGGAGACGACCGCTGCCGAATCCGCGCCGACAGCCGAGACTACGCCGCCACAAGACACGACGGCGCCCCC
GCAGTCGCTGTCCGAGGCCTCACGGCTGTTCGATGCCATCTCGGCGTGTGCTGATCTGCACCCGGACCGGTTCGGTGGCG
ACAACGACGATGACGACGATGCCTATCCATCCTTCTTTGGACCGGGCGAAGGCGACGACGACGATGACGACGGCATCGCT
TTTGATGACGGAGACCTGGAACCGGTCGAAGGCTTCCAGGGCGTCTTCCGGAGAGGTGCAAACAACAACACCGAAGCTGC
CGTCACACAGGGATCCGACCTTCCACCTCCTCTGCCCGGCAGCGGCGGCTGGATCACGGCCGAGAATGCACACGAGTTCT
TTGACGCCGACGGCAACTGGCTGGGACGCGACGGCAGCGGGCCTCTGGGCGAGGGCGCCGGACGCGTGCGAGGACGCGAC
GAGGTCGACGAAGCCGCAGCCGCAGACGAGACCAGCCGTGCAGACGCTGCGGCCGATGCGGGCGAGGCTCAGTTGAACGG
CGACGGGTCCGAGACCAAGCGGCCGCGGACAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62