GenePrediction:GLEAN_1765 Details

Name: GLEAN_1765
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:999682..1001794 (+ strand)
Length: 2113
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:999682..1001534 (+ strand)
Length: 1853
Type: CDS
Source: GLEAN
Position: GCSC_144:1001599..1001794 (+ strand)
Length: 196
>GLEAN_1765 class=GenePrediction position=GCSC_144:999682..1001794 (+ strand)
ATGACCGCCTTTCTCCTCACTCTCTGCCTCACTTCCGCCACCTCCCGCCTTCTCTTCCACGAAAATCTATTGATCCGCCG
CGATCGGGCCTTTGTCGTTGCCAGTTCTCGAAGAACGACGTCCCCTCTTTCTTGTCACTATTGTCTCCGGCGCTGGCGCT
ACCAATCTGCTCTTCACCGCAAGATCAGACGGCTCCAGCTCTCCTCCGTCCCCGCGGCATTTCCAGCCTCCATCTTCCTC
CGCCACAACTCCGTCCGGACATTCGGCTCGGCCAGCAACAAGGACCACCGCATCAGCCCCATCGATCGAGCCACCGTGGA
GCTTCTATTCGAGTTATCTAGCGGCACTATGGAGGGTTCAATCCCTCAGGCCGCCCCCCAGCCGCGCCCGCGGGTACGTA
GCCGCGGAGGCACCACTGCTAGCGAGACCCTCGACACGGCGGCAACCACTTCGGCACTGGTTAGCGGGCTGCGATCTTCG
GCAATGCCCCCGCCCCCGCTATCCTCGGTGCCCATGCCTCTCAGGACTGCGGCCGCTGGCGATGACCAGGACGACGAACT
GTACACGAGACCGTCACGGTCGGCATCTGTAGCTTCCCGCTCTAACAGGCTGTCGCTCACCTTGCCGATCGCCCTGCCGA
CCGCCTTATCGTCACGGCCGATGCCGGCGTCAGCAACCGTTGCCTCGTTCCCCTCTACGCCTGTCGACATTTCGGCCGTT
CTGGCCAATCCGTCCGACCCGGCCGAGATCATCACAGCCATTGCCGCACAGGAGCGACGAGTCCTCGAGCTGCGGGAAGA
CCTTCTTCGTGCCGAGGCGGGCCTCTCGAAGTTGAAGAGGCAATGGCAGACGTACGAGGTACAGCGCAAGAGGGCAGAGA
TCCGGCGGACTGAGCCCATGCGGCAGATGTCTACGAGGTCGGTGGCAGCGTCTCCGGCCACAGAGGTGGGATCTGTGTCG
ATGAACGGGTCGGACGTGCCAACATCGGATCCGGGCGATTCTGCCGAAGCAAAGCGCAGCGGTGAAATGGAAAGGCGAAA
GGCACTGATGGTTAACCAGCAAACGGGGAGCGTCCCAAGCACTCCGACCCAAGCCAAGAGGCGTGTGTTCACGGGCAGGC
ACACGAGGGCACTGTCTCTGCTCTCGCCTACGAAAACGGCAGTGTCGGATGGGGTTTCCATCCACGACGACCAGACCGAT
GATGAGGGATTCTACAAGTCTCCCGCTTCGTCGCACGAACCAGACTCTCCCTTCCACCAGAACCTGAGCCGGTACGGACC
CAAGTCTGCTGTCCAGCTGCCAAAGCGGTCTTCTTGGGCACCACAGTCTGTGCACCAGGCGGCAGGTCTCAAGCAGGTCG
CCGGCGACCTCACGGCTGCTATGTGGACATTTGTGGAAGACCTTCGCCAGGCCACGGTGGGTGACGAAGCTGTCCACGGA
AACACATTGGCTATGCGCAATGGGGTTGGGCCTTTCGGCGACGAAGATCAGCAGGGTACGATTCGTGCGTCGACCAACAA
CGCAACCCGGCCAAACCTGACCAGAGCCTTCACAGCCGATACGCAGGCAACGGCCACGTCGACTCCTCGGAATGTGAACC
CAGATGACCAGAATACAAAGGATGGCGTGGCACCGGATGCGGGCAACGGCGGGACGAAGCTTTCGAGATCGGGGTCGAAA
AAGACGAACAAGCGCTTCTCGTGGACGCCCCTCACAGTCGATTCGTACGACGACAACGAGTGGTCGAGCTGGGATAGTCC
GCCGACGACGAAGTCACCTCGATGGAGCGGGTCGACGATGAATGCAGACGTCTCTGGGATACCGGAGCAAGTCGACGAGA
ACACAACATCGCTGTAAGTGAACGAAGCAGAGAGAGACTCCGGCCCAACACGTTGATTTCTAACTTGCTCTTTGTAGGAA
CAATGCTATGGTTTCGTCATCGTCATCGCCGTCAGCCAAGAGGACGACCGAATGGTCGGCTGCGCTAAACCGGCTGACGC
CCGGCAACATCAAGCGGACGGCCACTGACTTGATGAAGGAGTGGGAAAAGAGCCTGACCATGCCACTTGAGACCGCTGCG
GCACAGGATTTCACTGGCAGCACACAAATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62