GenePrediction:GLEAN_1766 Details

Name: GLEAN_1766
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1002622..1004605 (+ strand)
Length: 1984
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1002622..1002790 (+ strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_144:1002865..1003481 (+ strand)
Length: 617
Type: CDS
Source: GLEAN
Position: GCSC_144:1003545..1004492 (+ strand)
Length: 948
Type: CDS
Source: GLEAN
Position: GCSC_144:1004549..1004605 (+ strand)
Length: 57
>GLEAN_1766 class=GenePrediction position=GCSC_144:1002622..1004605 (+ strand)
ATGGAGCAGATGGGCAAGATCTACTCGGTGTCGGGACCTGTCGTGGTCGCCGAGGAGCTGGATGGCGTGGCCATGTACGA
GCTGGTCAAAGTAGGCCGGGCCCAACTGGTGGGTGAGGTTATCCGCATCAGCGGTGACCGGGCCACGATCCAGGTGTACG
AGGAGACGGGTAAGCAGCTCGTCCGTGCCAATGACGTGCAATGGCCTTGCATTGATGACGCTGACCCACGGCCCGCATCA
CAGCCGGTCTCCAGGTCGGCGATCCGGTAGAGCGGACAGGCAAGCCGCTCTCGGTCGAGCTCGGCCCCGGACTGCTGAAC
AACATCTACGACGGAATCCAGCGGCCACTGGCGACGATTGCGGAGATGTCCAAGAGCATCTATATCCCGCGCGGCGTGGC
GGCCAATGCGCTGGATCGGCAGAAGAAGTGGGACTTCACCCCGACGGCCAAGGTGGGTGACCACATTGCGGGCGGTGATG
TCTGGGGCACAGTCTACGAGAACTCGTTCATCACGGTGCACAAGATCCTGCTGCCGCCGCGGGCACGCGGCACGATCAAG
CGCATCGCCGAGGCCGGCAGCTACACGGTCGACGAGAAGATCCTCGACGTCGAGTTTGACGGCAAGACGACGTCGTACGG
CATGATGCAGACGTGGCCGGTGCGTGCGCCGCGGCCGTCGACCGAGCGGCTGACCGCCAGCCAGCCGTTCCTCGTCGGGC
AGCGCGTGCTAGACTCGCTCTTCCCCTGTGTGCAGGGCGGCACCGTGGCCATTCCGGGTGCCTTTGGCTGCGGCAAGACG
GTCATCAGCCAGTCGGTGTCCAAGTTCTCCAACAGCGACGTGATCGTCTACGTCGGATGTGTACGTTTTACGTCTTGGCG
GGACCGCGAAGTGCGGTGGAATGTTGACTGACTGACCAAACAGGGAGAGCGAGGCAACGAGATGGCCGAGGTGCTCAAGG
ACTTCCCCGAGCTCTCGATCGAGATTGACGGCCGCCGCGAGCCCATCATGAAGCGCACGACGCTCATTGCCAACACTTCC
AACATGCCGGTGGCAGCGCGCGAGGCCAGTATCTACACTGGCATTACGGTGGCCGAGTACTTCCGGGACCAGGGCATGAA
CGTGGCCATGATGGCGGACTCGTCGTCGCGCTGGGCCGAGGCGCTGCGTGAAATCTCGGGTCGTCTGGGCGAGATGCCGG
CCGACCAGGGCTTTCCGGCGTACCTGGGCGCGAAGCTGGCGAGCTTCTACGAGCGCGCCGGACGGGTCCAGACGCTCGGC
TCGCCGGAGCGGGAAGGCAGTGTCAGCATCGTGGGTGCGGTCAGCCCGCCCGGTGGTGACTTTTCGGACCCGGTGACGTC
GTCGACGCTGGGCATCGTGCAGGTGTTCTGGGGTCTGGACAAGAAGCTGGCGCAGCGCAAGCATTTCCCGTCGGTCAACA
CGTCGCTGTCGTACTCCAAGTACACGACCGTGCTGGACCGGTGGTACGAGAAAGAGCACCCCGACTTCCCACGGCTGCGC
GACCGCATCAAGCAGCTGCTGTCGGACTCGGAGGAGCTGGACCAGGTCGTGCAGCTGGTCGGCAAGTCGGCGCTGTCGGA
CCCCGACAAGATCACGCTGGACCTGGCAACGCTGATCAAGGAGGACTTCTTGCAGCAGAACGGCTACTCGGACTACGACC
AGTTCTGCCCCATCTGGAAGACCAACTGGATGATGCGCCTGATGATGGGCTATCACGACGAGGCCCAAAAGGCCATTTCC
CAGGGCCTGCCGTGGACCAAGGTGCGCGACGCCACCCAGGAGCTGCAGGGACAGCTGCGCAGTCTCAAGTTCGAGGTGCC
GTCCGATGGCGAGGAAGTGATTGTGAAGAAGGTAAGCGAGGAGAGGGAAGAAGTCCATGAAACAGGACAAGATGCTGACT
CATACAGTACGAGGCAATCCAGGCGGCAATGCTCGACAAGTTTGCGTCTGTTGTGGATGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62