GenePrediction:GLEAN_1769 Details

Name: GLEAN_1769
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1030366..1032817 (+ strand)
Length: 2452
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1030366..1030370 (+ strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_144:1030441..1030541 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_144:1030599..1031048 (+ strand)
Length: 450
Type: CDS
Source: GLEAN
Position: GCSC_144:1031337..1032817 (+ strand)
Length: 1481
>GLEAN_1769 class=GenePrediction position=GCSC_144:1030366..1032817 (+ strand)
ATGGCGTGAATCCGAAAACTGATACTTGAGAGACGGGACATTGGGAAGGCCAGGCTCCTGCCTATATGCTACCAGGGGCG
ACGACATGGCATACAATTGGTTCGCAGCGGAGCGGGCGTCAATGTTTCTGGCCCTTGACGAAGCTTGCGAACAGATGGAA
AGGCGTGCTCGTGAAGGTGCGTAAGAATAACAACGGTATTCCCCGTTATTTATCCTGCGCACTTGTCTGATAGTCGTGAC
TGTAGATGCCACCAGACAGGGGCTGCTATTCAAGAAACAACTTGACGACTCTAAAGCCGAAGATGCCAAGAAACAGCTAC
AACTTCAGGCTGAAATCAGAGCGCTGAAAGACCAAGTAGTCTCCTTAACATCTGTCATCAAAAAAGCCGAGGCGGAACAG
AATGTGCCTGCCGACGCGAATACTAAGCCGACGGGCATTAGTGGCGATGGGCAAGACATAGAGATTGATCCTGCCGAGCT
TCAGCGTGACTTAGAGATCTCCCAGTCTCGATATCGAGCCGTCAAGAAGCAGTTTGAAATCGCAGTGGCGTTGGCTAGGA
AGAGAAAAACCGAGGCGCTGAACTGGGTCAAATATGCGGACAGCTTGGAACTGAAAATCAAGAAGCTGGAGAAGAAAAAG
GCAGTCAAAAGTCTTGCAAATCCCGCCACGGTGGATGCAGCGAGTAAGTCATCCACTCTTGCTGATGTCTCGGCGACCGA
GCTGCCCGTCCCAGAAAGACCTCAACCAGAACGGCCATTGACAGATGCCCTGGCCGATGTCCTCAAAGACGTTGGGCATG
GGTCCTCTCGGTCGAAATCTGGTGCAAGTTTTACGTCAGCCACTGCCTTTTTGGACAGTTTTGGTTCACATGGAGACAAG
GGCATAGGAGACGCCAGTGACGCAGATGATGATGCACAACTACCTGTCAGGAAAGCAAAATCGTCACTACCCAATCAACT
AAACGCTACAGATACGGCCAACGAGGCAATACTTGGCTCGACACAAGGTGACCCGTCTTCGGATGACGGGATTGAGCCGC
AGCTTCCGGTAGTCTTTCCCTATGCTAAGGAGGCCAAAGACGATGTTGTCGTTAAGAAAGAACCATCGTCAGACGGCCCG
GAGGTGGTCTGGGAGCGACCAGCGAAGAGAGCGAGGCGGGACGCTGAAGCTGAGAACACACGACCACACACACCAAAGTT
GTACGCGACAATAAAAAAAGAATCGTCAGACTATATCTGTCATGGGTCTGGATTGCCTATTCCTGCGTCCCAAGAGAGCT
TGGACCTTGACGAGGGCCAGCTTGCCATGCCAACTCCAAGAAAGCGACAGCTGGTGTATCACGATATTCCTTCCTCAGAG
GCAGATGATACCCCGACACTGGACAGGAATACATTGCAGAGTCTAGACGAGACTGACAAAACCCCACGCCCAGCTGCCCA
AGCTGCTGCCCTGACGCCGCTATCTGTTAATATGCGCCGCACTACGAAAGGTACTGGACAAGATAAGCAGCAGTTGAAGC
GTGGAGTAGACACCATAACCGAAGACAACGGAGGACGACCTATGACTGGTGGGCAGATGAACCCACCCAGCACTTCAAAA
TCTGCCAAGCTACACTCGCTGCTTAATTCGCGGCCGGTTCAGCCAAGTCCGATTTTGTCGGTACCGCGGGCGGTAGTCCA
GGCAAAAAACATGGACAGTCTTATATCAGGAGGCTTTGGGGAGCCGCCGCCGGTGCGCACCCTGCCACAGAAGCACGATG
TGACACCTTCATCCAGGGCCCCCAAGGGCGTGAGAACGGACACTGGAACGACGAGCTCTGTTACGACGACGCCAAAAGCT
CGCGAAGCCGGCCGGCGAATAATAACGCCATTGACAGAGGCTCTTAGAGCAGCAGCGGCTGAGCACGCAAGCAAGAAGGG
CAGTCTACGAGGCCGAGGAGTTGACCGGCTACAATTGGACGACTTCAAAGTCAACCCCGCCTGGAACGACGGGGAGACCT
TCGCCTTCAACGAAGTAGTGCGAAGTCGAACAGACCGTGGAAACTTGGCCGGTTGCACCGATCCACAGTGCTGCGGCAAA
GCATTCCGTGCTATGGCCGAGTCAGAGCTGAATGCGTCTGGGCCCAGTCACATGTCACGACCGGACAGTGTGGCAATGAT
GGAGCGACATTTGGGCGATGAGGCATTTGTGCTGGCAAGAATGCCGCCCGACGAGAAGAAGGAGTTATGGCTGGAGGCCA
AGACGAAGCAATTGGCAGACAAATACGGTAAGCATCGGCATCGGTATCACCGACGAGCGTCGCCACCTGGATTTTGGGAT
GCCGACTTCCCGACAACACAAGAGGAGGTGCACAACCGGGCAGAGTCCAAGAGAGCCGAGCGAACAGCCGTGCAAGAGCG
GTATCGGGAAGCGATGCGACCAAACGGCCGCTGGCTTTTCCGTGATGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62