GenePrediction:GLEAN_176 Details

Name: GLEAN_176
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1188638..1189738 (+ strand)
Length: 1101
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1188638..1188716 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_179:1188798..1189738 (+ strand)
Length: 941
>GLEAN_176 class=GenePrediction position=GCSC_179:1188638..1189738 (+ strand)
ATGCGAGTTCGTGGAGCACCAGCCATTGCAATTGTTGCAAGCTTGTCTCTCGCCGTAGAGCTGCAAAATAATTACTGCAG
TGAGTAAAGCGATACTCACTACAAAACGAAGATATCTCGCTACTGTGGCAGGAGAGTCGTGTGCTGACCATGCGTTGCAG
TCGCCTCTACGCCACAGGACACAATTGCACACATTGATTCTCGTCTTGACTATTTAAAAAAGAGCCGTCCAACCGCGGTG
GATCTCTTTAATGCTATCGCCAATTTGAAGACAGCCGTACGCGAAGTGCCGGTGTCGGCCCTTGAAGACTCTGCGGCCAA
GGCACTCATCATTGAGACGTACATCAGGACTGCCGAGCACATTCTCGAAAAGGACCTCAAGACAAACCTGGCCATCGGAA
ATTTCGGTGCTGACTGGCTGCAGCAGCAGTCAGGGGCTTCGGATGACCGGCAGATATCTGTGCTGACACACTGTAACACG
GGATCGCTAGCCACCTCCGGCCACGGTACGGCACTCGGAATCATCCGCTCGTTGCATGAACGAGGGCTGTTGCAACATGC
GTATTGCACAGAAACACGACCGTACAACCAAGGCAGTCGTTTGACAGCTTTCGAGCTTGTTTTTGAACACATACCGAGTA
CTCTTCTGACCGACTCGATGGCTGGTGCCCTCTTTGCTCTTGAAAAGGAACACATGAACATCAGCGCTGTGATCGTCGGT
GCTGATCGAGTTGTGCGTAATGGCGACACGGCAAACAAAATAGGCACCTACTCGCTTGCTGTTTTGGCGCGCTTTCATGG
CATAAAATTCATTGTCGCGGCGCCGACAACTAGCATCGACCTTAAGACAGAAACCGGAAAGTTTATCAAGATTGAGCAGC
GAAAGAAAGAAGAACTCTCACAAATATCCGGTCCAGTAGTACTCCCTGATGGATCAGTTGATGTGAACCAGAACGCCAGG
GTGGCTATTGCTGACCAGCATATCAATGCGTGGAATCCGGCGTTCGACGTCACCCCGTTCGCACTTATTGACGTTATTGT
TACCGAAAAGGGCTCGATAACGAAGAATTCTGATGGCAATTTTGATTTGACCCGTATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62