GenePrediction:GLEAN_1770 Details

Name: GLEAN_1770
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1033679..1037070 (+ strand)
Length: 3392
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1033679..1034289 (+ strand)
Length: 611
Type: CDS
Source: GLEAN
Position: GCSC_144:1034572..1034695 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_144:1034783..1035628 (+ strand)
Length: 846
Type: CDS
Source: GLEAN
Position: GCSC_144:1035809..1035898 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_144:1035961..1037070 (+ strand)
Length: 1110
>GLEAN_1770 class=GenePrediction position=GCSC_144:1033679..1037070 (+ strand)
ATGATGAGCAACGGTCATCTGCCGGCTGGGCGAGCTGCTCAAGGTGGAGGAGCAGTCGGCGCAAACGCTGTTGATGCTCC
GGTCCATGACGACCGGGGTGGAGGCGGACCGGGTGGAGGAATGGGTCCCGGCGGCGGCGGTGGTGGCGGTGCTCGCAATG
GCGGCGGACGGCGTGGACGGCAGTACGGCTCGCATTACCAGAACCCCCGGCACAACCAGAACGGGTTTCACAACCAGAAC
AACCACCACAACCAGTACGGCCACCAGCTCGGGCAGCAACTGGGACAGCAGCTTGGACAGCCAATGTACTCCAGCTACAT
GGGTCCCTATGTCAACAATCCTTACGCCTATGCCCCAATCCCGCCGCAATATGCACAGAATGGCGCAATGCCAAACGGTT
TTGTGCCCTTCCAGCATGCCTATGGCCGACCGATGGCCGGAGGACCCGCCCAATATGCACCTCTGATTCCGCCCGGTGCC
TTGCCGATGCCCCAGACGGCTGCTGTGCACCAACCGCCGCATCCGTCTCTTCCTCCGCACCCGCAGCATCTCCAGCACTC
CCAGCATCCACAACACCCAGTCCAACACCACATACCACCACCGCCACATCTGTCTCCGTACTCTCGAAATGATCCCGTTA
TTGTGTCTACCTCCTTGGCTCAGCAGCCACTGCCGTCATCTCTGCCACCGTTACCACCTGCGCATGCTCCGCTACAACCA
CCCCAAACAGGTCTTCATCAACACATGCCTCTCCTAGCGCGCGCCGACATTCTTCAACCGCCTCCTCATATAATGCAACC
GCCTCTACAGCCTCCTGTTCTATCTCCGACCCCTTCATCCACTCTTTCATCACATGCTATCCCCACCCCGCTGTCTCCTG
AGACGGCGCAAAGAGATGGTGTCCCTCAAGCACCTAAGGTGGCCATCGACACTACAGCCGTGGGCTCTGAAGCAGCTTTT
GCAGCTACGATGGGCATCGCTGCCGTCATCGTGCCCACCGCAGCGTTTCGGCCCCCTGTAAGCGGTTTTGTCAATGTTCA
GGATATAACGAAATTCGGCGACATGGCCGTGGACCTGTCTGCTGACATACTCAATGACGTACAGCTTCCTTGGTTGTCCA
GACCTGATGTCCCATTCCCTGCTAAGAGCCCAAAGCTGCGCAGGAGAAGGAAAACAATGGGAGATAACGTGGAGCTCCCA
CAGAACTCTTCCGATACTACTGCAACGACGGTGGCTTCAACCCTGGAAGAGTCTGGCACGACAGAGCCCATCACGCGGAC
GGAGACGCCTTCCACACAGGACATTCCATTTGAGGACGCGCCTTCCACCTCGCCGACAACGCCGAGCTCTGTTCAGCCCG
CTGGACAGGTGCTTTCATCTGTGACCCCAACGCCAACAAAGTCAACCATTGTGAACCCGAAGTCCACCGGCAGCACAACG
CGTACGGCTGTTCCTATAATCCCTGCCATTCCTATGCGGTCACCATCCGATAAGGCTTCCGCCACAGAAACAACGGAAGT
TGCTATGGCGGTACCTGTGTCGTCGGCTGAAAATGGACAGAAGGCCAGCACTTCTGAGGAGCAATTGGAATCGGTGAAAC
CGTCTGCGGAACCTACCACAACCACTCCCTCGGTGCCACAGGGACCGAAACTTTGGTCGGGCTTGTTCAACAGAGCAGCG
GCCGCGGCCGCAGCCAGCGCACAGGCTGTATCGAACGACTCAGCTGCTGGGGGTGACCAAGCCGCAAATGGCGCCAATAG
CACCGGCGCATTCTCCAAGGCCAAGGCGAACTCTTTGGCAGAGGCTCTAGTCGCGTACCGCGTTGATACCTCGAGCAGCG
TAGCATTTATTGAACCGCGTGGCCTGATCAACACTGGAAACATGTGTTACATGAATTCGGTTCTTCAAGTGCTTATTTTT
TGTACCCCGTTTTACGATTTTCTGGACCAAGTAAGCCGAAAGGCTGCTTATAGCTTTAAGAGCGAGACGCCTCTGCTCGA
TGCCATGTAGGAATCCCCTTGTCTACGCTCCGAACGGCAAAATACTAATTTATGCTTTAGGATTATGTTTATCCGTGAGT
TTAGAGTCATTGATACCGCGGATCCGGTTGATTTGCGCAGACGCTTAAAGAACGACGATTTGGAACGTTATGGTGATGCG
TTTACTCCCGAGTTTGTGTACGAGGCGATCAAGCAACTATCTCGCTTCGAGAGCATGAGAGTGAGTGCCCGTATTGTCTG
CGCTTCTGGTTGTAGCTGAATACTGACGATGTATTATTTTAGCGTGGCCACCAGCAGGATGCAGAGGAATTCCTTGGCTT
TCTACTGGAGTGTCTGAACGAGGAGTGCACAAAAGTGGTACAGGATTCGTCTCGTGCTACAAACCCTTCATCGACACAAG
TGACGACACCGACTGCCTCTGTCACGTCTGAAATCCCTGACCTTTCTGGCGGCGACGGTTGGCTCGAGGTTGGCCCGCGC
CAACGTGCAGCCATCACTCGCTCCTCGGGCCACACGTCTAGCTCACCAGTCAATAGCATATTTAGTGGCAAACTGCGGTC
CGAGTTACGTGTGCCTGGACTGAAAGACTCCGTGACCCTGGAGCCATACCAGTCTCTGCAGCTTGACATCGACTCACCCC
AGGTACGAAACATCTTGGATGCCCTGCGTGGCCTCACAAAGCCTGAAGTTCTAAATGGCGACTTTGGCTCTCCGCATGGC
AAAGATGTGTCTGTGACGAAGCAGGTGTTTATTGAGACTCTCCCACCGGTTCTCATTCTTCACCTGAAGCGGTTCCAATT
TGACTGGCAGGGCAATGGGACTGTGAAAATCTGGAAGAAGATTGGCTATCCTCTGGAGCTGGAAATTCCACGCGAGATCT
TTGGCCGCCAGAAACGCAACAAGCTTCTCACGGAACGTCTTCCCAAGTACCGGTTGAATGCGGTGGTGTACCACCACGGG
AAACAAGCTAGCGGTGGCCATTACACTGTCGACGTGCTCCGTGAGGATGGACGTGAGTGGATTCGTCTCGACGACACTGT
GATTCGTCGCATTCGCAGCGAGGATGTGGCCGAGTCGGGTGCTGAAGAGGCAGTTTCCGGACGCACGGAATCGAATGTGG
TGAACGGCAATGGCACGAAGAACGAGGCGGCCTCCTCTGTGGTGGGCAACGGCGTGGGGTCTGCGAACCGATTCGCTGGG
ATGGGAGATGAAGACGCTGGTGACAACGAAAATGGCTGGCGGCAGGTGACGGCACCTGTGAACGGTGCCAACAAAAAATG
GAGCAGCGTGGCCAACGGCTCTTCGAGCCCGGTCAACCAGGCCAAGCAACACAAGGACAGCATCAAAGACAATAAGGTTG
CGTATCTGCTGTTTTATCAGCGCGTGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62