GenePrediction:GLEAN_1771 Details

Name: GLEAN_1771
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1038024..1044149 (+ strand)
Length: 6126
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1038024..1041806 (+ strand)
Length: 3783
Type: CDS
Source: GLEAN
Position: GCSC_144:1041987..1042048 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_144:1042123..1042145 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_144:1042482..1042611 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_144:1042661..1044149 (+ strand)
Length: 1489
>GLEAN_1771 class=GenePrediction position=GCSC_144:1038024..1044149 (+ strand)
ATGTCCAACCATTTTTCTTTCCCGGACGACGACGACGACGAGTTCTCATCACCGGCGACGCCGCAGCACAGAACTGGCCG
AGGCGCCCGGAGTAAGAATCTCTTCAGCTTTGACGGTGAACACCCATCTACGACACCGGCAGGACCGCCGCCCTCATCGG
CAGGCAGCTCGACGCCAGCGGGCGCGCCATCGGCATCGTACTTTGGCAGCTCTGTGATGCGAGGCGGTACGGAGACAGGC
CGGTCGACGGTTGAGCCCCGGAATCTATTTACGGGCGGCCAACGCAACAATGGAGGCTTCAGCAATGCCCGCGGGCCCCT
CGGGCAGTCGATTCAGGGTGGAAGATCATTTGGGACACGGCAACCGTCTCGGCTAAGCCAGGTTGTGCACGATGAAGGGG
ATGAAGAAGACGAAGAAGAGGAGGGGACGGAAGAAGGGACGGAGGAGGGGACAGAAGAAGGGACAGAAGAAGAAGAAGAG
GAGGAGGAAGAGGAGGACGACGGCGACGAAGAAGAAGAAGAGGAGGGCTCGGAGGAAGACGCAGAAGGAGAAGACGAATA
CGACGACGACAAGATGCAGGGCAGCGATCCATGGCTCGATCTGGCCAATAGCGGGATGCAGTCGAGACGAACGTTCGGCG
GCAGCACAGCGTCGCCGGTGAAGCGTGGGCCGTGGATGTCGACGTTTGGCGCAGACGCCGAGGCGGACGAGACGCTGGGC
GACGAGTCGAATTTGCTCATGTTTGCGACGCCGGCAGTCAACAACCGGATTCGCAAAGAGGCCGAAGACATATTCCGGGC
GTCGGTGGCGCGCAATGGAGGCCAACGGCCGCCGGGAGAGTGTCGGTACGCGTCAATCGCCAAGGGCATGTACACGCAAA
TGGGGTACGCGTTGCTTGTGGAGGCGCCAGAGCTGATCCGACAGACGGAGCTGCACATCAGCCGTCTGTACAGCGAGGGT
GTGGGTGCAGAGGACGACGCGGGACGGCTGGACCAGGCACTGGCGGACGCATCAGGCCAGCTGGTGTCTCTGTGGCAGGC
GTACGCAGACAGTCTGCCACAGGACGAGGAGCAGACGACAGGGATCGGGCCAGGGCCGGGGGCCAGCGCGTTTGAGAAGG
CAGCATACGTGGCGACGCTGGCACTTCAGGTGCGACACACACGCAGCACGGCAAGCGATGGGACAAGTGAGCCGGAGCCG
CTGACGGAGACGCTGTTCCGATGGATGTCGGAGTACCACAACATGTACCCGGACCAGGTGAACGAAGTGCTCCGGTGCCA
GCCAGGGCCGGCATCGCACGGGATGTTCTGGCAGACAGTGTTTGTCAGCCTGCTGCAGGGACGGGTGGACTCGGCGATTG
CGCTGCTGCGGGCGGGAGGATGGGAGACGGTGCGGCGGGCAGGCATGGCGGCCTACACGGGACGGGCGCTGGCCAACGTG
CAGCGAGCAGTGGGCGAGACGATTGGGATGCTGGAGATGTGTCCGGGCAAAGCGGACAACTGGGACATCTGGAGCAGCGA
GTGGACGATGTTCCGGATCCGGGCCAAGGGCACGCTGGATCAGCTGCGGCGATTTGCCGAGGGCCAGAGCAGGACGGAGG
ACGAGGAGGACGAGTACGAATACGAGGACGAAGACGGCGACAGCTTTGCGGGGTCGCAGCGCAGCGGTGGTGGTGGTGGT
GGTGGTGGCAGTGGCAGCAAGCGAGGACGAGGGTCGATGGCCGGGCTGGCACGCAAGGCTGAGAGCCAGGTGCCATGGGA
CATCTACGAGAGCCTGAACATTGTGTTTGACATTGCGCTGGGATCGCGGGAGCGAATCCTGGCGGTGTCGCAGGACTGGT
GTGAAGCAGTGCTGGGGCTGTTTGGCTGGTGGGACGAGACGAAGGTGACAGCAGCAGACCAACGGCTGCAGCAGGGCGGA
CTGCCGTCGTTCCGACAGAGCGGCGGTGGTGGCGGTCTGCGACCGGCGATGTCGCTGACGATGTCGATGGGGTTTGGGTC
CGGTCATGGCTTCCGGACGGTGTCGACGTGGGAGAGCTACCTGGACCGACTGGCGCGAGCATTCCAGGCGACAGGCGAGG
CAGGACTGGAGATCAACGCGAACAGCCCGCTGGAGGTGGCGGTGGCGTGCGTGCTGGAAGACAACGCACGTGGACTGGTG
GGGATGCTGCGGGCGTGGTCGCTGCCGGTGGCGGCGGCGGTGGCAGAGATCGGGTCACTGGGGGGCTGGCTTCCGGCACA
GACGACGGGAGCAGCAGCGATGGCAGCGATGGCCACGGGAATGGGGGCGGGCGGACTGGCGACGGCGTTGGGCGACCTCG
ACATGGAGGACTTGGAGGTGCTAGGAGTCGACCCGACAGACCCGGACGAGACAGACGGGCTGAAGGACAATACGCTAGTG
CAGTATGCACAGGCACTAATCAACGACGTGGAGCTGGCACCGGGAAATGGAGGGATGGGGGAGAGCGGAAAGAGTGGAAA
GAGTGGAAAGAGTGGAAAGAGCGGAAGGAATGGAGGGGATAACGACGACATGAGCGAAGACGACAGCAGGGAGGACAGCG
ACAGCAACGAAGAGACTTCCCCAAGTCAGATGGAGGGCTGGGAGCTGGCAGTGCGGGTGTTGGGCCGGATGAACTCGCCA
GAGCGATCAGAGGACACGATTGGCGAGCTGGTGCAGACGATGCTGAAACGACTAGACGTGGACTGTGGCGTGACGATCGA
CAAGATCTGGCGGCTGCTCAGTGACCTGGACATGGGAACGTTTGCGAAAGAGGTGGCCGAGCACTACGGCGACCTGCTGG
TGAACGAATCGCACCGATACGGCGAGTCGGTGTGGTATTACGCCGTGGCCCATCGAGCTGACAAAGTGCGCGAGGTGCTG
AACCTGCTGATATCATACTCGCTGCTGCAGTCGGCGGCATATCCGGCCGAGGCGGAGCTGGACGACCGGCTGCGGCAGCT
GCTGTGTCGGCGTCGGGCCACACTGGAGCAGTTGGCACGTCGCGATCTAGACGCAGCCGAAATGCTGGGCCGCATGCTGA
GCGGCTATGCCACACTGCGCCGGTTCTACGAGCTGCGGGACGACGAGACGGTATCGCTGGCGCGACGGCGGCCGGCAGCA
GCAGCTGCGCTGACGGCTGTCATTGCCAGTGCCGACGACAACGTCCGCGGCGGGTTGTACGACAGCTCGCGCGACTCGGT
CGTGTCCGAGGACTTTTTGCTGGCGCTGCTAGGCGAGGCTCTGGTGTTTACAGAGGCGTCTTCGGTGTTGGCAGTGAGAT
CAGTCACGGGACCAGTCACGGGATCAAAATCGAAACCCCTCACCACTGCCGACTTGACGACAGCACCGCCCGTGATGGCA
GCCGAGACGATCGATGTACTGCTCAAGGCGGTCGAGGACCTGCAGACGCTGGCGGGCTCGCGCGTGTACGCGGCCTGCGA
CGAGTTTTTCCAGGTCGTGCTGGCGAGCGTGCCGGGCGGGCTGTGGGGGGCGACGCCGGCCGACCTACTGCGCAAGAGCA
CGGCCAACCTGTCGGGCAGCGTGTCGTCGTCGTATGTGCTGGCGGGCAGCTCGATGGTGGCGAGCCAGCTGCATCGGGGC
TTGGGGGGGGCAGCAGGCCCTGCATCATCCACGGCCGTCCGTCGTGGCTGGGACTGGCGCAGCGACCTGACCGCCAGCAC
GACGGCAACCGAAGTGCTGCAGCGCATGCGCCAGGGCCTCAGCCGGGCTCTGGCACGGCTATGGGTGGCCGAGGCCGACG
GTGCCGCCATCCCGTCGCTGCTGGTGTCCTAGGAGGGCAGCCTCGGGGGGGGGAGGATAAGGCGTGAAGCCAGAGCCAAA
AGGGACAGGACCAGGGAGAGGGTCAGAGAAAGAGCTAAGGAGAGAGCCAGGGACAGAGCTAGGAACAGAGCGAGAGCCAC
GGCCACAACCAGGAACAGGGCCACCCAACTGGACCGCAACCAGGAGAACCAGCACCCGACGGCCGAGCGGCTGCCGCTGT
CGACAGGCGGCATCCTGATCGACGTGTAACAAACAGGGAGTTTGAGGCACATGTAGAATGAGAACAAGAACAGAACAAGA
CGACTGGAGACTGAAGTAGAGCCGAGGTCCACGGCTCACGGCGTAAGAGTGTTGATTACGTAATGCGTTCCAAAAAATTA
CAGCCACTTCAACGGTTCTCGTCCCGTTTGTTGAGGAAGGATCGGTCGTCCAGAGGGGAGCCACTAAATGAGAATGAGAA
AAAAATGAGAAAAAATGAGCTGCCTTAGCTCCATATCTCTCCCCACCAGAGCTCCCTTCAGCCGATTAACAAGCATATAT
GGGCCGGACTTTTGTCCCCTCTCATTTCTTAGCAGATCGTGATTGCATCCGATTTCGCCGTCTCTTGCGCAGGACAGAGA
CCAGACTAGCAGGCACCTCCATTGCTCTTCTGGGTCTGGCTTAGCAGGTGTTGTACAGGAGCAGAAAGGATGACCATGGG
CGACAACAAGGACGTGACTGTGAGCGGGACAGCCGAGACGGAGGCGTTGGGGACTGCTGAGCAGGAGATTGTCGAGTATG
ACATTGCCCGGGTCGAGCAGGTGTACCGGTGAGTTTGGCTGAAGGCGACGTGCATCATTCTTTGCTAAGGCCAGCAGGAA
ACTCGACAGACGGATCATTCCAGCCTTCTGGGTGCTCTACTTTCTCTGCTCGGCGATCCGGTCCAACATTGGGATCGCCC
AGACGATGAACGAAAGCGCGGGCCACGATCTCAAGACGAAGCTCAAGCTGACGGCCAACGACACGTCGACGGCCCTGACG
CTCTTCTACGTCTCGTACGTCCTCTTCGACTTCCCGTCCAACCTGGTGATGAGCCGGCTGAGCCCACGGATCTGGATGGC
ACGCATCGTCTTTGCCGTCGGCGTGATCGGCACCTGCTTCACAGCCGTGGGCGCCGCCTGGAGCCTCAAGCTGCTGCGCT
TCCTGTTGGGCGTCGTCGTGGCCGGCATGTGGCCGGGCATGGCCTTTTACCTCACTCTCTTCTACCCGCCGTCACGCACG
GGCAAGCGCATCGGCATGTACTTTACGGCTGCGCAGATGTCGGCCGCCGTCGTCGGACTCGTCTCGGCCGGCTTCCAGCA
GATGGACGGCCGCTGCGGCCTGACCGGCTTCCAGTGGATGTTCCTCGTCTACGGCCTGCTGGCCGTTGTGCTGGGCGTCG
CCCTGCTCTGGTGGCTGCCTGATCGACCGCTGGTTCCTGGCACCGTGCGACCACCTCCTGCGCACTGGCTTCTTGCTTGG
GTGCCGAAGCCGGCCGAAGCACTCGTCGGCGACGACGCCGTCGTGCACTACCACGATCTCCGACGCGTCTACCACGCCCG
ACCTTGGACGCTGCGCGATCTAGGCCGCGTGCTGCTCGACTGGCGCCTCTGGCCGCTCGTGCTCATGTACTTTGGCGTCG
TCGGCGTCGGCATCGGCACCCAGCTCTACGGCTCCGTCATCATCGCCGCCATGAACCCGCATTTTAGCGACATTGTCGTC
AGCTTGCTGTTCGCCCCCATTTGGATCATGGACCTGATCGCCATCCTGCTGGTCACCCCCGTTTCCGACCGCTTCCACCG
CTACCGCGCCGTCTTCTTCTCGGCCGCCGTGTGCATCCAGATCGCCGGTCTTCTCGTCGTCAGCTTCGCCCCCGCCTCCA
AGCCCTACTCTCGCTACGGTGGCATGCTGATGCTCGGCTTCGGCCTCGGCCCCACCGTGCCCATCTGCATGACCTGGACC
AACGAGATCTTCCAGCGCCGCCACGGCGAGGTCGGCGTGGCCGCTGCGTCTGCCCTCGTCTCTGGCCTCGGCAATCTTGG
CAGCATCACCACCACCTATGCCCTCTACACCGGCTGGCCGGCCGACGCTGCTCCTGGACCCCATCAGTACCGCGACAGCA
ACCTGGCCATGATCGCGATTCTCTGCGTCAGCATCGCCAGCAGCTTCGCCATGGTCGTCCTGCTGCGCGTCTTTGACGGC
AACGCCAACCTTGACCCTGTCGATGGTGCTGCCCGCCGCGAGACCCAGCAGCGTGGCTTCCAGCACATGTGGCGCTGGGG
CCGCAAGCCGCAGCAGCCGTCGACGAGGTCGACGACAGTGGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62