GenePrediction:GLEAN_1772 Details

Name: GLEAN_1772
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1045023..1050546 (+ strand)
Length: 5524
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1045023..1045035 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_144:1045092..1047180 (+ strand)
Length: 2089
Type: CDS
Source: GLEAN
Position: GCSC_144:1048127..1048177 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_144:1048256..1049060 (+ strand)
Length: 805
Type: CDS
Source: GLEAN
Position: GCSC_144:1049115..1049282 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_144:1049333..1049691 (+ strand)
Length: 359
Type: CDS
Source: GLEAN
Position: GCSC_144:1049763..1050291 (+ strand)
Length: 529
Type: CDS
Source: GLEAN
Position: GCSC_144:1050351..1050426 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_144:1050479..1050546 (+ strand)
Length: 68
>GLEAN_1772 class=GenePrediction position=GCSC_144:1045023..1050546 (+ strand)
ATGGCTCAAGAAGGTGACACTCTGCTTGCGCGCCCGTCGACGGCGTTCTTACCCGCTAACATGGTACAGTGCGCGTCTGC
GTCTGTGGCGACGAGGGCACGGGCAAGTCCAGCCTGATCGCTTCTCTGGTCAAGGACGTGTTCATCACAAACAAGATCCA
GGCCGTGCTGCCACAGATTGCGATTCCGCCCAACATCGGCACGCCCGAGAACGTGACGACGACGATTGTGGACACGTCCG
CGCGGCCGCAGGACCGGACAGCCCTGCGCAAAGAGATCCGCAAGTGCAACGTGATTCTGCTGGTGTATGCAGACCACTAC
AGCTACGAGCGGGTGGCACTCTTCTGGATGCCCTACTTCCGCTCCCTCGGCGTTAATGTCCCCGTGGTGCTGTGTGCAAA
CAAGTCGGACCTGGCAGGGCCAGGGGATGGCGGAGGCGGAGGCGGAGGCGGACGGCCTGGCAGTCCCGGGCGGCCCGGCA
GTCCTGGAAGTCCCGGCAGCGGCGACGATGCGACGTTGGCACAGGTGCTGGACGAGGAGATGGTGCCGGTGATGCAGGAG
TTTCGCGAGATCGACTCGTGCATCCGGGCCAGCGCGCGCAAGCACCACAACGTCAACGAGGTCTTCTTCCTGTGCCAAAA
AGCAGTGACGCACCCAATTGCACCGCTGTTTGACTACAAGGAGGGCGACCTGAAGCCAGCCTGTGTGGCAGCGCTGCGGC
GCATCTTTTATCTCTGCGACAAGGACCAGGACGGCTTTCTCAACGACCGCGAGATGCATGCGTTCCAGGAGACGACATTC
AACCGGCCGCTGGCCCCTGAGGACCTGGCTAGCATCAAGCTGACGCTGGCCAAGACGGCTCGCAGTGGCGCCAACAATGG
CAGCAGCAGCAACAACAGCACGGCTGCTTCCCATCGGCCACCATCCAGCCTCGGCCCGGCCGCAGCACAGCCGCCGCTCG
ACCGCGGCATCGACCTGGCCGGCTTCCTGCAGCTGAACCGGATCTACGCAGAAAAGGGCCGCCACGAGACGATCTGGGTG
ATCCTGCGCAAGTTTCGCTACACCGACAGCCTCAGCCTGGCCGACAACTTTCTGCACCCGCGCTTCGAGGTGCCCGAGTA
CGCGTCGGCCGAGCTGAGCCCAGCAGGCTACCGGTTCTTCATGGACCTGTTCCTGCTGTTCGACCAGGACAACGACGGGG
GGCTGAACGACGCGGAGCTGGCGGCACTGTTTGCGCCAACACCCGGGCTGCCAGGCTCGTGGATCGAGGAGGGCTTCCCG
GCGTCGACGGTGCGCAACGAGGCCGGCTACATCACGCTGCAGGGCTGGCTGGCGCAGTGGAGCATGACGACGTTCCTGGA
GCCGAAGACGACGCTGGAGTATCTGGCCTACCTCGGCTTTGAGGCACCAGCAGGGGCCAAAGAGGCGGCGAGCCCAACGA
CGGCGGCGCTCAAGGTGACGCGGCCCCGGAAGCGACGGCTGCGGCGGACAGGCCGAGCCGGACGTGTGGACCGCAACGTA
GTGCTGTGCTACATTGTGGGAGCGCCGGGTGCCGGCAAGTCGGCGCTGCTGGACGCGTTCCTGGGTCGGCCGTTTGATGG
GCTGCACCGGCCGACGATCCGGCCGCGTCGGGCGGTCAACAGCGTCGAGCTGGAGGGGGGCAAGCAGTGCTACCTGATCC
TGGAAGAGCTGGGCGAGCTGGAGCCGGCGGTGCTGGAGAACGCGGCCCGGCTGGACGCCTGCGACCTGCTCTGTCTGGCG
TACGACTCGTCCGACCCGGACTCGTTTGGCCACCTGGTGGCGCTGCGGGAGCGCGAGCATGGTGGTGGCAGCAGCGGTGG
CGACAACGGACTGCATGGCCGACGAATCCTCCTGGACGAGCTGCCGACGGTGTATGCGGCGCTCAAGGCGGACCGCGACA
AGACGACGCAGCGCAGCCCGCTGCAGCCGGACGCGTACACGGCGGCGCTGCGGGTCAGCGCGCCGCTGCACGTCAGCGCG
ACCTGGGAGAGCATCGGCGAGCTGTTTGAGCACCTGGCCGAAGTGGCGACGAATCCCAGCCTCGGCTTCCCCAAAGGTGA
GGAGCCGGCGGCCGACCGGACGAGCCTGTACGTGGCGCTGGGAGCAGTGGCCTGCGCAGCGGCAGCGGCATTTATGATGT
GAGTTGTTGGGGTTGTTTCTTTTTTTTCTTTTTCTTCTTTCTTCTTTCTTCTTTTCTTCTTTCTTTCGATTCCCGTTTCT
TTACCTTTTTCTCGTTCCTTTTCCCCTCCCCTCTTTCCCTCCCCACTAACATCTCAGCTGGCGTAGGTCCACCAGCCAGC
CGTAGGACGACCGGCAATGATACCCAACACTAATTTACTGCTCGGCGTTGAGGCGTTGTCGTTTGACAAATTTGGTCTGT
AGCATCCATATAGCATAGAGCGTGTAGGATACGAGCTGTATAATAAACGATAGTGTTCTCAAGGCTTCCCCGCTCAATGC
CTACCCCACAAAAACCACCACTGGCCCACGCTATTAGCTAATAGCAGTGGAAGTCCCTTAAGCCCGCCACTAGCTCACAA
AGCCTCACATTCCCCAGCATTATTGACTGAGCGTCCCGGCCGCCTGAGTCCGTCCATCCTCAAGACGATCTGAAGAAGCA
GAACGAAACGCCGTCCAGCCGTGTCCGCCCCCACCGACAAGCACATACACACTCCGGCTCCCCAGCACCTCGCGCAGCGA
TCTTTCACATTGAGTTCCCCGACAGAGAGTCGGGCTCTCTGGCTGCATTGTCCTCTGGCCATCTTATCTTGGCATTGGAT
TGCGCGAGATAACAAGCGACCCGCCCTTGTCGTCTTCCCTTCCTCTCAATATTGGAGTCTTGGCCGGCAGCCAGAACGAG
AGCTTGCGGGAAGGAGGAGTCTGCAGCAGTAGCAGCTAAGACCACCACCACACCCTCTTGCCTTTGGGCTGAGCGATCGA
CACGGACAGGCGATCGACCGGCGGAATCGAATCGCACTATAGAGCCAAGCAGAAGAGTAACAGCACAGAGAGAGAGAGAG
AGGGAAGAAGATTGTGAGCAGGAGGAGGTGCGAACAGGGCAGGTGCAGACTTGCAAAAGTACAGACCGGCGATACTGCCG
AGGACACAGACAAAGCAGAGCACAGCAGCCATGTTGTAAGACCGTCTTCTCCCCATCGTCTCATCGTCTGCCCATCGTGT
TGCCATAGCTGACCAGCCACTCCCCCTTCGCAGCGTCCTTCCGCCCCCGCCGCGCTATCCGGTGCAGATGATGTATGGCG
GCATGTATCCGGGCGGCCAGGCGATGCCGATGGTCGAGACCAACAACACGCTGACCCATCCGACGGGCCCTGACTGCCGC
TTCCTCGTCGGCGAGGGTCTTTATGTTTTGCAGGAGGACCTCTTGCTGGCCACACCGCCGCCTCATCCGTCCGAGTCGCC
CGTGGTGAACATCAACCCGCTCGCCACCACGCCGCTTCCCGCTACAGCTGGCACCCGCGTCTCTCTCACCAGCATCGTTG
ACCCGCCGTCTCCGCCGGCCCTCTCGCTCCTGCTGGCCAGCTCAGCCGCAACAGCAGCAGCAGCAGCAGATCCATCTCCG
GCCGCTGCCTTCTCCCCCGTCGAGGAGCACCCGACCGAGAACGACTCGGCCGGGGCGGCTGCCACCGGGAGCAGCAGCCA
GCACACCGACTCGGCCACCACCGGCCGGCTCAGCTTCAGCTTTCACACCTCCAGCGACTCGGCCCTGCCAGGACAGACCA
CTACAGATTCTCCGGCCCCTCCTCCCACCACAACGGCTACCGCCACTGCTGTCGGCCTCGTCGTGGCTGGTCTCGGCGGC
GTCACCCCTCGGCCGGTCGGTGGCAAGCTGCGCAAGCCCAAGAACAACGTGACCAAGAGCAACTCGTCCTTCATCTCGCG
CGTCATCGTGCACGACGGCCTCACTAAGCGGTTGCAGGAACGGCCGCCCGACGGCCTCTTCGGCTTTGCCAATGTCAACC
GCGCCTTCCAGTGGCTCGACCTCGCGTCCGACAAGAAGGTGTGTGTGTGTGTCAAGGCGCTTCGAGGTGCTTCACGGTTG
CTGACTGTCTAGGGCGACTACCTCACCAAGATCCTGTTCACAAAGGCTCACTGCCTGTGCCACGATATCAATATGCTGAC
TAAGTCCACGTCGCACATTGACGTAATCATGGGCTTCTCTACGGGCGAGATCATCTGGTGGGAGCCCATCTCCCAGCGGT
ACACGCGACTGAACAAGAACGTGCGTCTGTCCGTCTTTGTCTTTCTTTCTGCCCGTGCTGACAGCTGCAGGGCATCATTC
GCGGCACGCCCGTATCGGAGATCCGCTGGGTGCCCGGGTCCGAGAACCTGTTCATGGCCGCCTTTATGGACGGCTCGCTC
GTCGTCTTCGACAAGGAGAAGGAGGACGCCGCTTTTGCCGTGGACGAGGAAGAGGCCACGCGGCAGCGGGCGTCGCACCA
GCACGACGCCCGTACGCACATCCAAGTCGAGCGGTCCATCCACTCGCGCGGCCACAAGGCGAACCCGGTAGCCTTTTGGA
AGCTGTCCAACCAGCGGATCAACGCGTTTGCCTTTGCGCCGGGCCAGAGCCTGCTGGCCGTGGTGTCGGAGGACGGCTCG
CTGCGCATCATTGACTATCTTCGGGAAGAGTGGGTTTTTTTCTGTTTGTTTTCTGTTTACTGGCTTTCATCCTCCCGCAC
GACTTACTCACACCAGACAGACTGCTCGGCCTCTTCTACTCATACTACGGTGGCCTTACGTGCGTCTGCTGGTCCCCCGA
CGACAAGTACGTCGTTACTGGCGGCCAGGACGACCTGTTGTCCATCTGGAGCGTTGCCGACGCCTCGCTCGCTGCCCGCT
GTCAGGGCCACCACTCGTGGGTCACCTCGGTCGCCTTTGACCCCTGGCGCTGCGACGAGCGCAACTACCGCTTCGGCAGC
GTCGGCGAGGACTGCCGCCTCTGTCTCTGGGACTTTAGCATGGGTATGCTGATCCGCCCCAAGGCTGCCGCCGCCGCTGC
TGCTGCTGCTGCTGCTGTCTATGCGTCGTCCATCCGCTACGCGCGCAAGGGATCCGTGGCTTCTCGGCACCTCCGGGCAA
CGTCGTCCGGTGCTGGCGAGAATGGCGACGGCGCGGATGCGGAGGCTGATGCAGAGGCCGATGCAGACGGAGATGCAGGT
GCAGACATGGACGAGCGCGTTCATCTCGTGGAGCCGCGAGCACGCACTGCATTGCTGCCACCAGTCTGCGTGCGTAACCG
TCTTTCTTTTTGGTCTATGCGCGTTCCTATCGGACTAACACGTCGCAGTCCCAGGTGGTCAGCAAGGAGCCGCTCTGTTG
GCTTGGATTCACGGAGAAGTCTGTTTTGACAGCCAACAAGAAAGGTGCGTTACGTCTAGCCCTAGCACGATCACAGCTTG
CTGACATAATACTCAGGTCACATTCGGACGTGGATGAGGCCAACAGACAACACGGCACAGACGGACGAGGGAGCGTCGAG
TTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62