GenePrediction:GLEAN_1773 Details

Name: GLEAN_1773
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1054097..1056315 (+ strand)
Length: 2219
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1054097..1054158 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_144:1054234..1054377 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_144:1054453..1055230 (+ strand)
Length: 778
Type: CDS
Source: GLEAN
Position: GCSC_144:1055296..1056315 (+ strand)
Length: 1020
>GLEAN_1773 class=GenePrediction position=GCSC_144:1054097..1056315 (+ strand)
ATGCCCTTCAACCCATTTACCTCGGTGACCGGTCGCAATGCCCTCACTCTCTTCGACATCCGGTAGGCTTGGAACGCTCG
ACAGCCCTGGGCGTCGCCTTTCTTGTCTGCCACACTTGCTAACCATGCTGCTGCCAGGCTGGAGACCGACTTCCTGGTAT
TCCGTGGAAACGAGCACGAGGCCAGCGGCCAGATGCTAAAGGGCGTCCTGGCCATCTGCGTCCCGGCACCGATCAAGATC
GAAGACATCCACCTACGCCTGACAGGCGTGCAACGTTTGGCGTGAGTGTTACCCGAGATGCTATGCTGCGAGACAGACGA
AGACTAGAAAAGCTGACTGTCAACTTATGCCTCCAGATGGAACGACCCGAGATCAACGCCTTCAACCGGTCTGTCCTCAT
CCAAAATAGACCGCTCAAACGTCATCTTGCAGCACCAATGGGCTCCGTTTTGGGGTACTCCTGGCAAGAGCGCCATTCTC
GAAAAGGGCAACTATGAGTTTCCTTTTGACCTGTTACTCCCTGGCGACACGTCCGAGAGCGTTGAGGGTCTGCACGAGGC
CAGCATCACGTATAAGCTTAAGGCCACCATCGCCCGCGGCAAGCTCGCCTACGACCTCCATGCGTACAAGCACGTCCGCT
TCGTACGCACCATGGAGTCCTCGGCCCTAGAGTTCCTCCACGCTATGAGCGTCGAGAACGTCTGGCCCAACAAGATTGAG
TACTCCATTGTCGTTCCCCGCAAAGCCATCGTCTTTGGCAGCGCCATTCCTCTCGAGACCCGCTTCAGCCCTTTGCTCAA
GGGCCTCGAACTCGGCGATATCACCATCCGCCTTTTCGAGATCCACGAGTTCGTGTCCATGCCCATGGGCTCTTCCAACA
TTGTCATGACCGGCCTGCGCGAGTACAAGAACGAGCGCGTCGTTGCATCATGGGTGCTGAGCGTCAACAACGAGGACCAC
TGGAACGACATGATTGAGGACACCGGCCAGGAAGGCTGGGTGTTGAACACCTCCCTCGACCTCCCGCACAAGCTGGGCCC
GTGCATCCAAGACGTCAACGTGCACGGCATCAAGGTTCGCCACAAGCTCAAGATGGTCGTTGCTCTCAAGAATCCTGACG
GGCACGTCTCCGAGGTAAGTCTATCGCATAATGCGCCCGCCTGCATGCTTGGTTGGCATCGCTGACTCTCAACGCACAGC
TGCGCGCCACCCTACCCCTGACCTTGTTCATCTCGCCAAACATCCCCCTCGACGAACAGGGCAACCTGACATGCCCGGCC
CGAATCTCGGCGAGTCCGCAGGAAGCCGCCACACAGGCCACGATTGCACCGCCCGGCTACGGCGAGCACATCTTGGACCA
GCTCTACGACGAGATGGACGTCCACAACCTGCAGACGCCGGCCCCCATGTCGGCGATGCACAGTCCGCTGTACGGGCTTT
CGCGTGCCGGATCTAGCGAAAACTTGGCATCAATGGCCGCGGCCGCCAGCATACCGGTGCCACCCGCAGCTCTCACATCA
CGGCTGCAGGATGTCTCGTTGCGCGAGGCGACGATCCGGAGAAACCGCAGTTCCACGCATATCACTCCTCCCATCTCCGG
TGTCAGCACGCCGTATTCGCCCGTCCACGGGCACCTCTACTACCAGCACATGCAGCAAGTGCAGAACCAACAGCTGCAGC
AGGCTCTCAATAGCGCAGACAGCAACAGCGGGACAGACTCGCTGTCAAGACGCAACAGTGGCGAGTCGCACCACACCGAA
CACAGCGACCCTGAACACGTCGACTTTTCCGACATGTCAGAGCTCTGCAAGGTCCCATCCTACGGTACGGCCATGAAGAA
CACGCGGGTGGCAGCCATTGCCATTGGTGACAGCGCACTGCAGCTTCCCGACTACCGCACGGCAGCTGCCTCGGGTAGCA
TGTCGCTGTCGTCCTCCCCCGTCATGAGGCCCGCCTTGATGTCGTCTTATACCGGAACCTCTCTCATAAACGAGCCGCTT
TCCCTGATCGCCGAGACACCGCAGGATGCTGCCGACAGTGTGGGCATGCGTCCGCGGAATGCCAGCTACCACAGCGAGAC
CAACCTTGTCGGCAGTCGGCGGCGCCATCAGTCGGGAAGTACCACGCCATCGAGCAGTCGGCAGAACACGCAGGGCGGCG
ACTCGGACGAGCGCAGCTGGCTGCACCTGCGGCAATCACGCAACCGTGTAGCCACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62