GenePrediction:GLEAN_1775 Details

Name: GLEAN_1775
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1073479..1074293 (+ strand)
Length: 815
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1073479..1073539 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_144:1073626..1074293 (+ strand)
Length: 668
>GLEAN_1775 class=GenePrediction position=GCSC_144:1073479..1074293 (+ strand)
ATGGCCAGCCCGTCCGAGAGCAAGGGTTTCGACTCGATTCCCGAGGCGATCCAGGCGTTCCGTAAGTCGCGAGAGAGCGG
AGAGAGGGAGCGAGCACGAGCGGGCAACCTGTCGTCTGTCGGCGTCGCTGACACAATCTGCCCGCAGGTGACGGCCAGTT
CATCGTCGTGGTAGACGATCCGCGGCGGGAGAACGAGGGCGACCTGATCATCGCGGCCGAGGACGTGACGACCGAGCAGA
TGGCCTTTCTGGTGCGCCACTCGTCGGGCATCATCTGCGCGCCGCTGTTGCCGGCACGGGCAGCCCGCCTGGGCCTGCCG
CCCATGGTGGCCGACAACGAGGATGTGCGGGGGACGGCCTACACCCTGACCGTGGACGCGGCCGACGACGTGGTGACGAC
GGGCATCAGCGCCCACGACCGCGCCCTGACATGCCGGCGGCTGGCTGACGACGACGCCGTGCTGGCTGCCGTGGCCGGCT
CTGGCCCTTCGGCCTTCCGTCGGCCAGGTCACGTGCTTCCGCTACAGGCTCGTCTCGGTGGCGTTTGCGAGCGTCGCGGC
CATACTGAGGCTGCCGTCGACTTCTGCCGGCTGGCCGGCAAGCGCCGTGTCGCCGTCATCTCCGAGCTTGTTGACGACGG
TGACGCCGTGCCCGGCCAGGCTATCCGCACCGGCTCTGACATGCTTCGCGCCGACGGCTGCATCGCCTTTGCCCGCACCT
GGGGGCTCAAGGCCTGCACCATCGCCGACCTCGTCGCCTACCTCGAGCAGACCCGGCCGCAGAAGTTTGCCGGGCCGCAG
GAAGATGAGGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62