GenePrediction:GLEAN_1776 Details

Name: GLEAN_1776
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1074799..1075521 (+ strand)
Length: 723
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1074799..1074835 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_144:1074908..1075521 (+ strand)
Length: 614
>GLEAN_1776 class=GenePrediction position=GCSC_144:1074799..1075521 (+ strand)
ATGGCACCCGATGTCGCCAGCGCGGCTCCCTCGCGGGGTGCGTATACTGAGCAGTACGACTGTCTCTGGTGGACGACGCG
GCTTTGCTGACTGTCTCTCCTGCGAGCAGAAACCTGCCAGAACGAGTTCGAGTCGGCCATCGCCATGACGCTGCACCTGT
GGCAGCCGCTCTCGTTTGCGGTGGAGAACCACCTGGGCGGTGGCGACGGCTCGGACAAGCGTGACTGGTTTGGTGGCGCG
GTGGCCGAGCTGTTTGAGGAGTCCTGGATCTGGACTTTGGCCGCGCCGCCCAGCAGCGCCCAGGCCGAGGACCTGCTCAT
GGACGCCGAGGCCCGCCTGATCCAGATCATGGACGACGAGTTCGACACCGTCGTCGACGACGGCAGCGCCTACGACATTG
CCAAGCAGATCGTCGACCTCTGGGCCCAGTGCCGCCGCGGCCAGTTTGCCAACGTTGCCGACCTGCGCCGCCGCTGGGAG
GCTTCGCGAGGTCGCAGCGTCTCGGGTCTCTTCCAGGCCGCGCGGACGGGCAACGACGACGACGAGTGGGGCACCGACGA
CGACGATGACGACGATGATGATGAAGACGCCGATGAGGACGACAAGGACGGCGGGGCTGACGTCAACATGGACGAGGCGC
CCGCGCTCGTCGATCGCGAGAAGAAGGCGGCGCCAGAGGTGGATGAGGACGGCTTCACAACGGTGACGCGTAAGAAGAGG
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62