GenePrediction:GLEAN_1777 Details

Name: GLEAN_1777
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1079172..1081127 (+ strand)
Length: 1956
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1079172..1079633 (+ strand)
Length: 462
Type: CDS
Source: GLEAN
Position: GCSC_144:1079706..1080850 (+ strand)
Length: 1145
Type: CDS
Source: GLEAN
Position: GCSC_144:1080923..1081127 (+ strand)
Length: 205
>GLEAN_1777 class=GenePrediction position=GCSC_144:1079172..1081127 (+ strand)
ATGTCGGCCAACCCGAACTTCCTCCTTACTCCCCAGCAACAGGAGCTTCTGTTCGCTGCTCTCAATGCCAATCGGCCAGC
CAACTCGGCAAACACGCTGACCCTGTCGCCCACTTCTCTGGATGGATCCCCTGCTGTCTCCAAGGCTCTCGAGCTTGCCA
GCGACAGCTACCAAGACAATTCGTTCCTGGACTACGACTATTCTTTCGATGCCGCCGACTCCAGTCTGAATTTCAGCCTT
AACCACGGCGATAACACCAACATGGCTGACGCCTTGGGCGATGGCGCCAATGACGATAGCAAAACTGAATCTACACCCAG
CACTACTGAGAACGACTCTCCTGACAAGAGAGTCCATCCCGAGGACGACGATGAAGAAGAGTCCTCGGCAAAGCGTCGCG
AGGGTGGCGAGAAGGTCCCCAAGAAGCCTGGCCGCAAGCCGCTTACGTCAGAGCCAAGCTCGGTGCGTAAAGCAATCGAT
TGTCCGTGTTACAGTGGTGCAACATGACTGACTGACATGGCTATCGGCTTACAGAAGCGCAAAGCGCAAAACCGAGCTGC
CCAGCGAGCCTTCCGCGAGCGGAAGGAGAAGCATGTAAGGGATCTCGAGTTAAAGGTTGAGGAGCTGGAGCGGACCTCGG
CGATCACAAGCAGCGAGAACAGTCTGCTCCGATCAAAGGTGGAGAAGATGAGTGTCCAGCTGAATGAGTACAAGAAGCGC
CTTGCCATTGTCGGCTCCTCCCGGGGTGGCTTTCTCGGATCTGGGCATCAACAATTTGGAAACAAAATCTTCAGCAACAT
TAACGATGTCAACTTTCAATTTGAGTTTCCAAAGTTTGGACAACTACCAGGGCCTTCGAACGGCTCAACAGCTACAGCAA
CAGCAGCCGCACGAAGCAACAGCCAGAGCAGCCCGACCGCTGTCGCCGCTGCTTCCACATATCGGTCGTCGACGATGGAC
ATCTCATCCCCGGCTCTGGATGGGTCGACGACTAGTGTTGGCGCTTTTTCCAGCAACCAAACCAGTCCTCAGGACACGTC
TCGTATCAGTCCAGCGAAGACGACCAAAGATGACTTGTCTAAGCTGTCCAATGCCTTCACGCCACCTCTCCCTAACAGCA
GCATCGCGACTGCGGCGAGGTCAAGCCTGGATTCAGGCGCTACAAGCTCTCCTTCGGCTTCCTCCAACAGCAACACTGCC
CCAAGCTCATCGTGTGGAACGTCGCCAGAGCCCTTTAATCAGTCTCCGTCTGCTTCCAAGCCTCTTGAAATGTTGACGAC
CATCGGGGAAGAACAGCTGACTGCGCTGACGGGCTCGAATGGCGTCCAAGACCATTCGCAGTTTGGTGGTGTCAATATCA
ACGACATTGCCTGGTCTGGCCCCCAGAACGGGTTCCGCTTCGACCCGCAGCTCTTCGGCGATTACCGCGAGTCGCAGGAG
AACATTCTCTCCAATGGCGGCTTCGATGATAGTTTCTTCAACGATGCGCTTGACATTGACTTTGTCACCCCCTTCAACAT
AGCCCCAAGCCCTGTTGTGCCCCACAAGCCGGATATAATTGCTGAAATCGATGCTGCGAAGGGAGGAGCGAGTTTTCCTC
GTCCTCTCTCAATGGCAAGCTGCCGGCCGGCCAAACTACCCCTCATGGAACTCTACTCACGTGCAACACAATATGGTATG
TAGTACTGAGCATTAACGAAAAAAAGGAATACTCTCCCTATCGTAAACGTGTTTGCTTACCACCAATATAGGGAGCGGCT
CCAAACATGTCCCAAGGTTCAGAACGGGGACTTTGATCTGGATGGTCTATGTTCTGATCTGCAGAAAAAGGCCAAGTGCT
CTGGCTCTGGTGCTGTCGTTGACGAGACGGACTTCAAGGCTGTCATGAATAAGTATCTCGGCAACAAAGACGGCGATGAT
GCCTGCGTGCAGAATCTCGCGGCTTCAATGCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62