GenePrediction:GLEAN_1780 Details

Name: GLEAN_1780
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1097299..1102428 (+ strand)
Length: 5130
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1097299..1097934 (+ strand)
Length: 636
Type: CDS
Source: GLEAN
Position: GCSC_144:1098087..1102243 (+ strand)
Length: 4157
Type: CDS
Source: GLEAN
Position: GCSC_144:1102323..1102428 (+ strand)
Length: 106
>GLEAN_1780 class=GenePrediction position=GCSC_144:1097299..1102428 (+ strand)
ATGACTTCTGCTGCGAACGCGCAGAACGTCCCGGCGCCGAACTCCTCCGCTCCCTCTGCCACTGCATCCTATGCTTCTGC
TGTCGGTGCTTCTGGCAAGGCCGCTGCGACGCCGGTGATCGTGACGGGCTCCTCTGCTCCTGTCGTGGTCAGCTCCTCTA
CGTCTGCTCCTACCCAGCCGGGTCACCATGCCAAATCTTCGTCGGTGTCACCTCTGAACGGTAACGCCGCGAACAAATCC
AACACCGCCACCATGGCTTCCGGAGCCACCAGCAAGCACATTGTGCCTGCTGTACCTGCTGTCATCAACGGCAGCTCTGC
CGACCACGCCCGAAAGAGCTCTGTGACCATCAGTGCCGCGGGCCCCAGCGGCTATGTCGCCAATGGAGGTCCGGCTGGCG
CTGGCCCAAAGGCTGGCATGCCCAAGTTCGGCTACGAATCGCCTGCTGTCGTTCACAGCACTCCTTCTCAGAACACTGCT
GCGCCTATCCCTATTCCAGGCCACCAGCGGATACCCTCGCCTGTCCCGTCTCCGTCTCCCATCCCTCAGCCGTCTGCAAG
TGGTGGCCGTCCGCCATCCACTATCTCCCAGGATGGCTCGTCCATGAAGTTTGGCAGCCTTGGCGGTGATGGCGATGTAC
GTCTTTTTTTGTTTACCCCCCTCCCCTCCCCCTCCCCCTCCCCCTCCCCCTCACCCTCACCCTCACCCCTCCTCACCCAC
AACTTTTTTTTTTGCTGTAACCCCTCTATTACAAACACCACCAGACTTGCTGACAACATGACTTATAGCGTCACATGAAG
CACAACACACCCAACTTGGGCCAGAACAACCTGCCCGTTGGCAATCAGTCGCCACACTTCCGTCGCGGCTCGACGCACTC
GATCCACAGCGACATTGGCAACCACGGCGGCCATGGCAACCACGGCAACCATGGACACGGCCACCATGGCGGCCCTGGCC
CCAACCGAGGCGGCTATGGACCTCAGGCTGGTCGCGGCCGTGGCTATAACAATGGCCACCAGTTTGGCAACCAGTCTATG
GGCTACCCACCCGCTGGTGGTCCGTACCCTCGTGGCCCATCCCAGGGTCGTGGCGGTATGCCACCACAGTTCCAGCCCCG
CGGCATGCAGCCCGGCTTTGTTCAGAACTCGCCTCAGGCAGCACGTGCAAGCCCGGCTATGGCACCGGCCGTCCCGAACC
CTGGAACGCCGATGATGCAGACTGCTATCCCCGCCAACACCGGTGTTAGCCCTGGATACATCAACTACGCTTACCAGCAA
GCGGCCGGCTTCCCGCCGCAAGTAAACGTAAATACTCCACTTTCTTTTTCGTCTCAACAACCCAAAAAGTTTCACCACTC
CAGCCGGAAGGGCCAGTCGTCCTTCCACAGGGGCGGAGGCAAGAAGAAGGGCCTAATTCGCGGCGAGAGATCGTTTTCGC
AGCCAGCTCTGGAGTCTGAAGCTGTGCTCGGCAATGCTTACCCCCAGGACTTGAACAAAAAGGCATCTCGCCGGCCCATC
AAGCGTTGGCCGGATTCCAGTGAAGAGCAGCCCAACCAGACACAGCAGTTCGAGGCAGCCTCGGCCATGGAGGCCTCGGC
ACCGTTTCAGCACTGGCAGGGGCCAGTGCCCCTACAGTATCAGCCTACGACCGGCAACAGTGTACTGGATGATCTATCGC
CGACGAGTGGCAACTTCGAGCGCCTGCTAACTGCGAGAAAACAGACGTACCAGCCGTACCCAGGTCAGTATAACAACCAA
GGCATGATGGGCTACGCTGGCTACGGACAGGTGTCCTACATGCCTGGACCGCAACAGTCTCCAGGGCCGGCATACGCGCC
AGCCTACGTGCCGAACCCATACGCCCCACCTGGCCCACAGCCCATGTCCCGCAACTCGTCGCAGGTCTCGGAGCGGCCGA
ACTCTAGCACCGGCCAGGGCCAGGTCGTGTCTGCCGGTCCCGGCGTCGGCGCCTCTGTCGCAGGTGTGCCGAAGAGTGCT
CCCAACGGACCTTCTTTTGTGATTCCCCGGAAAAGTGCTGCCATCATCATCAAGAACGCACAGGGTGAGATCCAGGATTT
CAATGCCCTGAAGGCTCCTGCATCTCCTGGACCGAATGTCCCGGTTTCCAAGACGCCTCCGGTCATCGCGTCGACCCCGA
CACCACCACCCAAGTCGGTCACTCCGTCTCACAGCCGGGCTGAGAGCACTGCTGCGGCGGCAAAGACTGCTGAGCAGCTA
CGGAATGAGTTCAAGGAGCAGGTGCGGAAGACTGCCGAGGTCGAGGGCGAGAAGGCTCCTGAATCTGTCGAGCCTGCTGC
TGCAAAGGCAGAGGAGACGGTCAAACCCGCAGAGAAGACGGACGCTGCTGTCGAGCCGAAGAAGACTGCACCGGTGGCCG
CAAAGGAGACTGCCCCGGCTGCTGCACCAAAGGCGGTCGAGGAGAAGAAGGCCCCGGCCCCTGTAGTGGTGAAGACTGAG
ACGGCTGCGGCTGTGCCGGAGAAGAAGGCAGAGCCTGCTGCGCCTGCTGCTCCTGCTGCCGCCCCTGCCGCTGCTCCTGT
TGTCGACGAAGAGGACGAGACAGAGCGGATGATTCGGGAGATGGAGGAGGCTGAGGCCAAGCGCGAGGCCGAGGAGGCTG
CTTATGCTGTGAAGAAGAAGAAGCTGGACGAGGAGAAGAAGAAGAAGGCCGACGCAGATCGGATCGCATCGGCTGCCGAA
AACGACCGGAAGCTGCGCGAGCAGGAACGCGAGATGGAGCGGGTCGAGGAGGAGCGCGAGCGCCAACGGCACGAGAACGA
GGCGGCTGCGGCTGCTGGCGTCCGGGTCAAGAGCGTGGCGGAGGTGCTTGCGGAGAAGATCTCCGGTCTGACTCTGGGTG
ACCGCAAGGAGACGGCCGAGGCCAGCACCGAGACGGTGACGAGCAAGCTGAGCAACATGACGCTCCTGGGCGCATCGTCG
GTGACATCGTCGGAGACGGCACCGGGCACGGTGAAGCAGCAGCGCACGAAGCCATCGGCCCTGAACCTGGCGCCGATCAA
CACCAAGTCAGTGGAGGCGCCGCAGCCGAGCGCAGCACTCCAGTCGCTCAAGACGGCGCGGTTCCTGCGGGATCCGACCA
GCATCCTCTACCCCAAGGGTGTGATGTCGCCCAACCCTGCGCTGAACCCGGCGGTCAACAAGAAGGGCAATTTCAAGTAC
GACACGGGCTTCTTGCTGCAGTTCAAGGACGTCTTTGTCGAGAAGCCATCGATGGACTTTGACCAGCAGGTCAAGCAGCT
GATCGGCGACGGCGAGAGCACGCCTCGGGCAGGCTCACGCACTCCGGCCTCGGGCTCGGTTCGACAGAACTCGCGCAGTG
CCGGCGGGACGACTGGCTTCACGATGGGCGTGATGGGCGAGTTTGCGTCCAAGACGCTGCCTCCGGGCACGACGTCGGAC
CAGCGGTTTGCCATGTCGAACGGGTCGATGCAGCGGCCACCAACGGCGGGCATGGGTCCGTTCGGCCGTCCGGGCAGCTT
TCCGGGCCCGGCACACATGTCGCGGACGCCGTCGGCCAGCATGGGTGGCGTGCCCAACTCGCCTCGGCAGAACAGCCGGT
CGACGCGCGGCAACAGCCGGCGGGATAACTTTGGCGGGAAGAATGAGGCACAGGCAGCCAAGACGATGCCGCTGACGGCT
GGTCAGGAACTGAAGCCGATCGCGGTGTCATCCAACGGCTGGAAGCCCACTAGCATTGGGAGCCGGGCGGTGCAGGCGCC
GATGGTGACGGCGGCCGGAATGCTGGACCCGACAATGGTGCAGCGCAAGGTCAAGGCGGCGCTGAACAAGATGACGCCGG
AGAAGTTCGACAAGATCTCGGACCAGATCCTGGAGATTGCGCTGCAGTCCAAGGACGAGGAGGACGGCCGGACGCTGCGG
CAGGTGATTCAGCTGACGTTTGAGAAGGCGACGGACGAAGCGCACTGGGCGTCTATGTACGCGCGGTTCTGCAAGCGAAT
GCTCGACATGATGAGCCCGGAGATCCGGGACACGACGATCAAGGACAAGAAGGGCGACGTTATCAGCGGCGGCACTCTGT
TCCGCAAGTATCTGCTCAACCGGTGTCAGGAGGAGTTTGAGCGAGGCTGGAAGGTGGACCTGCCGAAGCCGAAGGAGGGC
GAGTCGACCGAGGCAGTGATGCTGTCGGACGAGTACTACGAGGCGATGGCGGCGAAGCGACGCGGCCTAGGCCTGGTGCA
GTTCATTGGCGAGCTGTACAAGCTAGGGATGCTGACGGAGCGGATCATGCACGAGTGTGTGCGGAAGCTGGTGGACTACG
AGTCGGTGCCAGACGAGGCCGAGATCGAGTCGCTGTCGAAGCTGCTGCGGACAGTCGGAGGCAATCTGGACCGGACAGAG
AAGGGCCGTCCGATGATGGACGCCTACTTTGTGCGGATCAAGAACATGGTCGATTTTCCGGACCTGCCGAGCCGGCTCAA
GTACATGTTGATGGACATTCTGGACTTGCGGTCGGGCAACTGGGCGGCGGCCGAGCTGAACAAGGGGCCGAAGACGCTGG
AGGAAGTGCGACAGGAAGCCGAAGCGGCAGCAGCACAGAAGGCGGCCGAGGCAGCCCGGAGCACGAGCCAACGGGGACCG
GGTGGCCGGTCGGGCATGGGAGGTCGCAACGACAACCGCAACTTCTCGTACAGCCAGCCGGTACAGAACCAGGTCGGCAT
GGACGATCTGCGGCGGTTGAAGGGGTCGGCGAGCCGGATTGCGAGCTCGAGCGTGCCGACGTTGGGGCCGACATCGATGT
TTGCGTCTCGGAGCAACAGCGGTCGGCGAAACGGCCCTGGTGGCTCGTTTGGCCGTCCTGGCGACGACTCGGGCCCGGGA
TCGCGGGCAGGGACACCGCTGACGCGCAGCGACTCGAATTCGGTGTCGCATGCGAATGCGTTTTCGTGAGTTTCTCTGTC
TTATGTTGTGTTTTTTTTTTTTTCCTTCTTTTTTTTTCGTTTTCACAAACGCTAACATCACCAGTGCCCTCGCCATGGAT
ACGGACACGCCCACGTCGCCTCCTTCCACGGCCGCCTCGCCTGCCATTTCCAAGGCCAATTTGGACAAGGCCAAGAAGGA
CGGCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62