GenePrediction:GLEAN_1781 Details

Name: GLEAN_1781
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1108471..1114011 (+ strand)
Length: 5541
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1108471..1108548 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_144:1108667..1108966 (+ strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_144:1109035..1110689 (+ strand)
Length: 1655
Type: CDS
Source: GLEAN
Position: GCSC_144:1111057..1111172 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_144:1111254..1111387 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_144:1111600..1111699 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_144:1111815..1112275 (+ strand)
Length: 461
Type: CDS
Source: GLEAN
Position: GCSC_144:1112756..1112832 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_144:1113166..1113535 (+ strand)
Length: 370
Type: CDS
Source: GLEAN
Position: GCSC_144:1113589..1114011 (+ strand)
Length: 423
>GLEAN_1781 class=GenePrediction position=GCSC_144:1108471..1114011 (+ strand)
ATGTTCGAGGAGGTGGCGCACGCTGCCTTGCATATCCCTTCAGGCTCAGCGGGCTTTTTGCAACCCTCGGCCGACTGCGT
ATGCTGCAACACGATCGCAAGCCGCACAACCATTTCCAAGATTTCCAAGACGAGTCTTGACCGTTGCAACCGCCACGCCA
ACAAGACGTACAGCTTCGGCACCTATAACGACCGAGGAATTCAACCGGGAGTTGGAGGGAGACGCTTCCGAGGCCTCTTC
CACGCTATCTGCAGCAGCCAGCTCGCGCGTGGACGCCATCTCGAAGCGGCGCCTTCAATTCCTCAGGGACCCTTATACCA
TCGGCAAGCACGTCGAAGGTATTCTGCAGAAGGATGCAAGGGACGGATTTGAAAAGGCTCTGAGCATCACTCGGTTGGCA
AGCAAAGACAAGCAGGTCACGGTCAGCTGGAATCATCTGATAGGGTACCTCATGCGCAAAGGGAAGCTTGTTGCCGCTGT
CAAGCTCTTTAACGAAGTGAGAAGTCCAAACAGATCGTTGATGAGAGATGCAAGGACCGGCATTCTGACCCAGGTGGAAA
ATAGATGAAAAAACGGGCGCAGCTACCCAATGCACAGACGTACACTATCATATTCAAGGGTTGCGCGCAGTCGCCCCATG
CCAGCCTTGCCGTCTACCAGGCAACGCGGCTCTACTACTCCATGCTCGACAACGAGCGGATCAAGCCCAACACTATTCAT
ATGAATGCAGTCCTGCAGGTCTGTGCTCGTGCTAAGGATGTGGAGTCACTCTTCAGCGTGGCCAAGACAGCCAACGACCG
CCTGCGCATGCCCAACAACCTCACCTACACCACCGTTTTCAATGGCCTGCGCTATTCCACAGCGCTCCCCCACCACCGGA
CGGTCAAAGAAGGCGAGGAAGAGGTTCATGTGGACAAGGAGAAGGTGTCTGTGTCGATCAAGAGGGCCAGAGCAGTGTGG
GAGGAAGTGGTGACAAACTGGCGCCAGGGACGGATCATTATTGATGAGGAACTGGTGTGCGCCATGGGACGAGTTCTTCT
TATGGGAGACTACCACGATAACGATGACGTCCTGTCTCTCGTCGAGCAAACCATGGGCATCCCACGATTCGACCGCCCAA
CAATGTTGGCGGCCACACCGAAGACAGCCCCGAAGGAGCCGGCTGCTACTCCAATCTCGTCAACTGATGAGAAAGCTGTG
GCAGAGGACAAGACTGCAGCAGAAGACACAGCCGCAAAAAGGCCGCCTTCAGAGGGTCGGAAACCGCCGCCGCCTGTAGC
AGTCGCGCACAAGACCCAGTTTGTACCATTACCAGCTGGCGTCATTGGTTCCAAAAACCACAACAGTATCGAGGGCAGCG
AAGGCGGCAGCAGCAGGATCCTGTACTCGCAACCAGGCCGCAACGTGCTCTCGCTCGTCCTGACGTCTCTCGGCGCGACG
CGGAAGACGAGCCTTGCGGCGCGGTACTGGGAAGTGTTCCAAAGCCCGCCGTACTACGTGGTGCCAGACTCGGAGAACTG
GTTCCGGCTGCTGAAGGCGCTACGTCGGGGACACAACAGCGCCAAGACGGCGGAGCTGCTACAGAAGATGCCCAAGGAGC
TCATCAACGAGCGGACGCTCCAGTTGGCGATGGCGACGTGTGCGGCAGACAACCTGAACGACGGTGCGTTTGCATCGGCA
GGGAAGGTGTTGGACCTGATGAGCCGGACGCTCCTGGTGCCAGACCCACACACGATGCGTATGTACCTGCAGACGGCCAT
TACGAACAACCGGCAGTTCAAGGAGGTGGCGGACCCGAGAGAGCGAGAGGTGGCCAAGTTTGCGTTTGGGCGCCAGATTG
TGCGGGCGTTGGGCCGACTGTGGGATCCTCTGCGACTGGCTGGAAACGCACTCACCTACCCGGAACAGCCGTACGCATCA
GGGCCGGAGAAGCGGGAGCAGACGTACAACGGGCGGCGGGAGCTGGTGTCTCTGATACGACAGATGGTGTCGGCGGCCGA
CATGGTGGTGTCGGAGGGCATGGCGGACGAGGCGACGATAAAGGACGTGCGAACCAGCCGCAACCTGTTGAACCGACAGG
TCACGCGGTTCTACGAGAACCGGGAGGAGATGGAGCCGAATCTGAAGAGCGCACGAGAAAGGCGGGAGAGAAGAGCCAGT
TTTCCCAGAGCGCGCACGACAAAAGGATTCGCGACAGCGAGGCGGAATGCCGGCGAGCAGTAGGAGGACGGAATGGCGAC
CATCTCAATAGACAAATGAAGACAATACCCATTTGTACGGTGTATTTCGTACAAGAGTTCGGAGTAAGGCACGTGACGGG
GCCGTTTTGGGGTGTTGCGAACGCTGGCGGAGCCGCCTGCTGAATAGGGGTACATAGCACTGGTCAAGAAGGCTGCGCGC
GCCAAAGAAGAGCTGCCACGTTCGATAGGCACCGCCACGTTAGTCCGGTCCGCGTCCATTTTTCTTCGCTCTGTCCAGTA
GACCGAACTATTTGATTTTCTGTCGCCGTGCATCGCCCGTCCATCATCCATCTCAGAGGCCAGCCATTGTTGGCCGGATA
GTCCTTCGCCACGGCCGTTTGAGCAGACTTCTCTTCGAGGACGCCTTCGTCTCCAACAGGACGCGACCAAAACGCGTCAA
CCCGCAGCAAATCGCAGCCATGGCGAAAGTTGCATCTGATTTCGAGAAGATGATCCACGCCGGTACGTTATCGAGACGCA
TTTTTAATTTTGGCCTCGGGTTTGTGTGACCGAAAACTGACTGTTGCCCGTCTTCTCTCGCAGATCGCAATCGCAAGAAG
AACGAAGCCCTTGCGGCCCGGATCTTCAACAAAGACCGTCGATCCAGCGCGCCGATCAAGGCCACCGGTAGCGGAGCCGG
TGCCGGCTTGCTCACGAGTCGTGCCGGCGTGAAAAAGGTACGTTGCCATGACGCTCACGGCTTGCAGCCAGGCTTGCTGA
CCGCCGCTCAGCGCGTCTCCCTGTCGTCTGTCCCTCGGCCGACGGGCAACATCAACAGCGAATGGACCCATGACCTGCAC
AACGGAGGCGCTGGCAGCATCCCACGAGGGCCACGGGCAGCAGCAGCAGCAGCGGCAGCAGCAGCCTTGCCGGCGGGTTC
GCTCGCCAGTCGGATCTCGCGGCCGGGCCAGCAGCCCCTTCGGACAGGCAGGGCAGCAGCCCCGACAACGGTGGTGGCGG
CACGGGGTCAGCAGCGACGCGCCGCGCAGGTGGCCCGGGCGCTGTTCCGAGAGGAGCTGACGGGCGGCAAGAGGCAGACG
CGACAGCAGCAGCAGCAGCAGCAGCAGCCGGCTGCGGGTTTGTCGATTCGCGGCATCGCAACAGCCGTCAACGAGCCGCT
CGTGGTGATGGCCCAGAACTTTGCGCCCGGCACGACGGCAGCAGACATTGAGAGTGCGATGACGCCAGTGGGCGGGTTGG
TGAGCAGCTGCCGCATCCTCAAGACGGCGCCGCTGGTGATTGCCGAGATTGTGTTTGAGACGCGCGAGGGCGCGCTGCGC
GTGATCGAGACATTCAACAACCAGACGGCCGACGGCCGGCTGCTGCACGTGTATCCCAAAGCGGGCCAGCAGATGGCGAT
GGGGGCCAGCAGCAGCAGTCAGCCGGCGATGGCGGTACCGCGGGCGCTGGCAGTGGCCAACAGCAACGGCAGCAGCAGCA
ACGGCCTCGTCGTGGACGGCTCGCTCGGCTTCGACGACCCCATGGACACGGACGGGCTCAGCAGCAGCAAGCTGTACAGT
GACGATCTGGTCGGGTCCAAACCACCAACAGGACCCGCGGCCGGCGTGCGTCGCGGCGGCCGTGGTGGCCGAGGTGGCCG
CGGTGGCCGAGGCGGTCGACGATAGACGATAGTGGTAGCAGTGGCACTCGACAGCAGCTGGCAGCGGCTGGCACCAGCCA
GACGGCAGACGGCAGAGGGGCTTCAGGCGGATTCAACTGGCACATGTCCGTCTTCATTCATTCACGTTTTCGCTTGGTCT
TCTTGGTGTTCTGGGATTTCTTCTGTAGGTGTGCTGGATTACGTGGAGGCATGACAGTCCTGTGGGGGCTCATAGACAGG
AGGCAACGTGGACAAGTGCTCTGTAGGGATAAAACTGGGACACTGGTACTCCGTAAGATTTCAAGATTTATGTCTGGCCG
GCTCAAGACTGAGGCTGCTCGGATTATTAAGACAAGCATGTGCTTGGTCTGTGCGCCAGCACGGAGGATTAGCTCGACAA
CCTTACAAAGTTGCCCCACCTTGCTAATCTACGGAGTACGTGTAGGCCAACGTGCAAACACTCTCTTTTCGACCTCTTCC
CATACGGGCACTAGCAACGCACTTTGCTCGACGTCACTACACGTAAGGGTTGTCTGCCAATTCTGCGGCCGGTTCCGCTT
GGGCAGCTCTCTCTAACTGACTTTTCCTTCATTCGCAGCTATTCCGGGCCTCGTCTGAGCCTCGTGCCGTCCCCTCTCGA
ATGTGATCCCCGGAGCACGTCTTTTATGTCTCACGACCGCCCACTCTGTGACCCATCAGCCTTGTCCGAGATTCGGCGGT
AAAATCCCGTGTCGCCTATTGGAGTCTTTGGCCGCCATTTCTGTCCTATCCTTGAGACCAGACGCTGCAGGCCACGTGAT
ACGAAACCGGCGAGAACAGAGGATCGGATCGGCAGGAAAGCCATACAGAACGCAGAACAGAGAACAGCAAGCAGCAGATA
TATCGGGGGGAAGCCATGGCCAACGACGAGATCAACGTGCCGTCACTGGTGCTGATCCTGGTTGTCTCCGGCCTCCTGTT
GCGCCACTTCTTCTTCCGGGGACCGGCTCCGTCCTCTGCTGCAGGAGGAGCTGCGGCTGCGACGAGGACGTCGTCCCGAC
AGCCATCGACCCTCCAGGACCAGCGGCGAGCCGAGGCGCTGGACCGCCGCACCGAGGCTGCCGTCGACCAGATCCAGCAG
ATCTTTCCCACCGCAGACCGCCGCGCCATCTGGTGGGATCTACGACGTGGCAACCTCAACGTGGCCGCAACAACGGAGCG
GATCCTCGCCGGTCGTCTAGAAACGGTGAGTCTCGTCGGTCTTTCCCGCTGGCCTAACACTGCTGACCCGATCGATAGCC
GCCCGTCTCGTTCCAGCCTCCTGCACGGCCGACACCGCCTGCCACCGGAGCTGCCGCCGGCAACAGCAGCAGCAGCAGCA
GCAGCAGTGGCGCTGCCATCATCGCTTCCCGAGGCAGCAGCAGCTCCTCGTCGGCCCTGGCCTTGTCGCGGTCTACACAG
CCGAACCTGATCCAGCGCTACCACCTGCAGGACCGTGTGGCTTCCACAGACACGCCAGACGTCATCACGCCACCGCCGTC
GCCCTTGCCAAACACTGTAGCTCCTGCGGGCAACAGCAAGTCCAAGAGCTGGAGCTCCAACAAGGACGAGCGCCAGGCCC
TGCTGAAGAAGCGGCGGGACGACATGATCCTCGAGGCTCGACGCAAGATGGAGGCTAAGCTGGCCGCCGAAAGGGCCGCC
ACTGCCGGCCAGAGGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62