GenePrediction:GLEAN_1782 Details

Name: GLEAN_1782
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1121951..1123881 (+ strand)
Length: 1931
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1121951..1123664 (+ strand)
Length: 1714
Type: CDS
Source: GLEAN
Position: GCSC_144:1123736..1123881 (+ strand)
Length: 146
>GLEAN_1782 class=GenePrediction position=GCSC_144:1121951..1123881 (+ strand)
ATGCATATCCGGGACATGGTGGCCGAGGCCGAGCGGTCGAAACAGCCGTCGTTCTCGTTCGAATACTTCCCGCCCAAGAC
GGCACAGGGCGTGCAGAACCTGTATGAGCGGATGGAGCGGATGCACCTGTTCGGACCCAAGTTCATCGACATCACCTGGG
GCGCCGGCGGGCGGATCGCGGAGCTGACGACGGAGATGGTGGCCCAGGCACAGACGTACTTTGGGCTGGAGACGTGCATG
CACCTGACGTGCACGGATATGGGCGAGGACGGGATCAACGACGCGCTGCGGCGGGCGTACCAGGCCGGCTGCACGAACAT
ATTGGCGCTGCGCGGAGATCCGCCGCGGGATGCCGACAGCGACGGCTGGGTGGCGGCCGACAGCAAGTTCCGCTACGCCA
AGGATCTGGTGGCGCACATCCAGAGGCACTACGGCGACCATTTTGACATTGGCGTGGCCGGCTATCCGGAGGGCAGCGAC
GACAACAGCAACGAAGACGAGCTGCTGGAGCACCTGAAGCAAAAGGTCGACGCCGGCGCCTCCTTCATCGTCACGCAGAT
GTTCTACGACGCCGACAACTTCTTGCGCTGGTTGGCGCGCGTGCGAGCTGCTGGCATCACCGTGCCGGTGCTGCCGGGCA
TCATGCCGATTGCGACATACGCAAGCTTCTGGCGGCGGGTCAACCACATGGGCTGCCGCGTGCCGGCTGACTGGCTGGCC
GCCCTGGAGCCGGTCAAGAACAACGACGACGCGGTGCGTGAGATCGGCAAGACGCTCGTGGCCGGGCTCTGCCGCGCGAT
TCTGGCCGGCGGCGACATTGTCCACCTGCACTTTTACACCATGAACCTGGCCCAGGCAACACGCATGGTTCTCGACGATC
TTGGCTGGCTGCCATCGGCCGATCGGCCACGGCCTCCACCGGCGCTGCCATGGCGCCAGTCGCTGGCTCTCGGCCGCCGC
GACGAGGACGTGCGGCCCATCTTCTGGCGCCACCGCGGCAAGTCGTATGTCGCCCGCACAGCTGACTGGGACGAGTTTCC
GAACGGCCGCTGGGGCGACTCGCGCTCGCCGGCTTTTGGCGATCTCGGCAGCGCCTACGGCGCCGGTCTGCCTGGGTCCA
GCGCCCAGAACCGCGCTCGCTGGGGTGCGCCTCGCTGCATCGCCGACGTTGCCGCCCTCTTTGTGCGCTATCTCCTCGGC
GATCTCGCCTCGCTGCCCTGGAGCGACTCTCCCCTCACTGGCGAGGCCGACTTGATCCAGCCCGACCTCGTCGCCCTCAA
TCGCCGCGGCCTGCTCACCGTCAACTCCCAGCCTGCCGTCGACGGCGTTCCCTCGTCCGATCCTGTTCATGGCTGGGGCC
CCCCCAACGGCTTCGTCTACCAGAAGTCCTACCTCGAGCTTCTCGTCCCACCCGCTCTCTACCCGGCTCTCGCCGACCGC
GTTCGCGCTCATCCCCATCTCACATTCCACGCCGGCTCCCGTCATGGACCTCTCGAGACCAACGCCCCCGCTGATGGCCC
CAATGCTGTCACCTGGGGCGTCTTTCCCGGCAAGGAGATCGTCCAGCCCACCATCGTCGAGAGCATCAGCTTTCTCGCCT
GGAAGGATGAGGCCTTTCAGCTTGGCGCTGAATGGGCCCGCTGCTACGACGTCGGCAGCCCCAGCCGTGCCCTGATCAGC
CAGATGATGGACGAGTGGCATCTGGTCACAATCGGTAGGCCGTCCATCCCTTTCTCTTGCCGTGTGATACCGGGTCCACT
TTTATATGCTTACTAATCAATCCAGTCAACAACAACTTCCACCAGCCACGGACTATCTTCACCGTCCTCGACGGACTCGC
ACTGCCTGACATCGACAAAGAGGTCGAGGGCACCGCCGATACTACCGCCTCGGCTGTCAAGGTCAACGGTGCCGCCACCG
TCGCCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62