GenePrediction:GLEAN_1783 Details

Name: GLEAN_1783
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1143171..1145258 (+ strand)
Length: 2088
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1143171..1143259 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_144:1143332..1143349 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_144:1143421..1143458 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_144:1143577..1143611 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_144:1143676..1144707 (+ strand)
Length: 1032
Type: CDS
Source: GLEAN
Position: GCSC_144:1144767..1145258 (+ strand)
Length: 492
>GLEAN_1783 class=GenePrediction position=GCSC_144:1143171..1145258 (+ strand)
ATGGTTGAAGGGACGGGGCAGAAGTTTGCGGAGGCCACCACGATTGTGGCCGGGGTTGGGTCTCTCACAGCTACTCTCAT
GTCGATTGTGTATGTCGGCTGAATCGCACCTAAGGACACTTGATTGATTGCTAATCTCTTACCTTTGTGCTTCGACATCA
GTTCAATATGGCTTCAGCTGTGAGTTGATTTGGGCTTTCGTCTCCCCATGCGCCACGTGCTGACAAGCTTTCAGGAAAAA
CTACCGCAAGCCGTTACTTCAACGATACGTCGTTCGAATCCTCCTCATGTATGTTATTCGACCTATATATACATATTTTG
GCCACCATATGCGCCGGTTGTTGACTGTTAAAGGGTTCCTATTTACTCCATAGCATCTTGGGCGAGTATGGTATCAACAA
TTGCAGCCCAGTGCCTCGACCCCATCCGTGACATATACGAGGTTTGTGCTACACCCAGTCTTCCGGTTCTACCGAATCTA
ACTAGCCGACCTGCCTTATGTTCAGGCCTTCACAATCTTCACGTTTTTTCAACTCCTTATCAACTACCTCGACGGTGAAC
GGGCCCTCATCATAATGACCCACGGCCGTGAGCCCAAACCACTGTTGTTCCCCTTGAACCACTGTCTCCCTCCAATCGAC
ATCTCAGATCCACACTCCTTTCTGGCGGTTAAGCGGGGCATTCTTCAGTACGCATGGCTGAAGCCGATTCTTGGTCTGTC
GGCCGTCATCATGAAGGCTACAGGCACATATCATGAAGGGAAACTTGAGCTGAAGTCGGGATACTTTTGGAGCACCATCA
TCTACAACTTCAGTGTCACCATCAGCCTATACTCGCTCGGCCTCTTCTGGGTTATAATGCACGAGGACCTGAAGCCGTTT
CGCCCAGTACCGAAATTTTTGTGCGTGAAGCTCATCATCTTTGCGTCGTACTGGCAAGGATTTTTGCTCTCCGTCCTGGT
CTGGCTTGGTGCTCTCCCGACCGACATGGATGGGTACACACCGGATAATCTGGCGCTTGCTATTCAGGATGCACTGATTT
GTATCGAAATGCCAGCATTTGCAGTGGGTCATTGGTATGCGTTCTCGTGGCATGACTTTGCCGATGATACGGTGGCAGCC
GCCCGGATGCCGGTGAAATATGCTCTCCGCGACGCCTTCGGCATTCGTGATCTTATCGAAGACTCGAAGCTGACGTTTCA
CGGTAACAACTACGCGTATCGTGATTTCGACTCAAATGACAAGATATTGGCTCATGAAACATCTCGCTCGAGAATGGCAC
GGCTTAGAGCCGGCATGCGGTACGAACGCGGTGGCAAAGGAAAATACTGGATCGCAAGTCCTGACAAGGCGAATGCGAGT
GATGTGGATCCGTATACTCCTTTGCTTGGGGGCAACAGCCGTGATCAGTGCGTTTCTGGACCGAGCCGTAACAACTCCCA
GTCTTTTGAAAGCAGCACGTTTGAAGACCCCACGCTAGATCCGGATATGGAGAACCTCTATGCCAAGGCGCGGCAACTCG
AGTATGGTGACTGGAATGTATGTGATAAGCTGTTCTATAACGTGTTTGGTTGCTTCATTTCTGACATTACTCGCAGTATC
CTGTTGTCCCTGCGAACGGCCTATCACGAGAGGACCGCTGGAGGGCGGCGACTCCCATCTCGTATGGCCAAGTGCCGAGT
TGGGTGCCAAGCTACGATGCGCCAATGTCTCCAACAGTAGCCAGCGATAGAGGCACAACGCAAGAACAGCCACCAACGGT
CACAGTGACGAAGAAAAAAAGCAAACCAAAGCCCAAGAATGCGCCAGCTCGAAAACGAACACTGTCACACGACCAGAAAG
CACCAGTAAAACCCAGTGACGATGTCAATGATGTAAGCAGAGATGCAACCGGGCCAGTTTCTCCCAAAAGTCCGGAAACA
GACAACATCAAGGCCGACGACGAGGCAACGCGGCTATGGCAGCAGACTGGAGGGAACTCTGGAGCCGCAACAGAGCCTGA
GGACACAATCGCATCGCCGGCATATGACTTTCAGGGGGAAGCTTTTCAGAATGTATGGGGTAGCGGCGACAGCCCGGCAG
GACACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62