GenePrediction:GLEAN_1784 Details

Name: GLEAN_1784
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1149989..1153196 (+ strand)
Length: 3208
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1149989..1150040 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_144:1150264..1150322 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_144:1150419..1150733 (+ strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_144:1150799..1151236 (+ strand)
Length: 438
Type: CDS
Source: GLEAN
Position: GCSC_144:1151306..1152481 (+ strand)
Length: 1176
Type: CDS
Source: GLEAN
Position: GCSC_144:1152536..1152779 (+ strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_144:1152842..1152950 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_144:1153010..1153196 (+ strand)
Length: 187
>GLEAN_1784 class=GenePrediction position=GCSC_144:1149989..1153196 (+ strand)
ATGGAGGGAAACTCGGACATCAACACAATCCTGACCAATTCGTTGTCGCCAGGTACGTATTCTCTGCCTTGATTTTCTTT
GACTTTTGCCGTATTCACGCGCCTGCACCCACGATCAAGCCGGACAGTGGTGGGAGTGAGGAGGCGACGAGGGACGATCT
GCGAAGAGGCATCGGCTACGCGCCCATGCGCGCCTCACATACCGTCCCGTCATCAGAGCTAGTGGCCCCGTGTATGGCCT
CATCGCATTTTTATCGACTTGCTAACGATGAGCAGACAACACGTTGCGTCAACATGCTGAACAGCAACTCGAACAGGCGG
CTGTTACAAACTTTGTATGTCTTCCCCACAATCACTCCATTCATCTATCCCATCCATTTCATCCCCCCTCCCTCTTAGTT
CTTCACTAACTGTGCTCGCGTATTCCCTAGTCTCTGTACCTCGCAACACTCGTCCAAGAACTCGCAAAGGAAGATGCCCA
GGGCCACATCCGAGCCGCTGCTGGTCTAGCCCTAAAAAATGCATTCACTGGCCGGGACCCGGCACGGCAGGCTGACCTTC
AGGCGAAATGGCTGCACCAGACCGACCAGGAAACCAAGACGAACATCAAGCAGCTCGCCCTTCAGACTCTATCATCGACC
AACGCTCAGGCTGGCCAGGCCTCTGCCCAAGTCGTCGCCTCTATTGCTTCTATCGAGCTCCCCCGCAATTTATGGCCCGA
GCTTATGCCCTCGCTCGTACAGGGTGTTAGCGACGGCCAGGTCCACCAGAAGCAGGCCTCCCTCACAACAATAGGCTTCG
TTTGACGTAGAGCCAGGATCCGGAGTTGCGCACCAGCTTGATTGGCTTCTCCAACTCAATTTTGACTGCCGTGGTCCAGG
GTGCTCGCAAGGAGGAGACCAACAACGACGTCCGGTTTGCTGCCATCACCGCTCTCAGTGATTCTCTCGAGTTCGTCGGC
AACAACTTCAAGCACGAGGGCGAGCGCAACTATATCATGCAGGTTGTCTGCGAAGCCACACAGGCTCCCGATAGCCGCAT
CCAACAGGGTGCATTTGGCTGCTTGAACCGCATCATGGCCTTGTACTACGACAACATGCGCTTCTACATGGAGAAGGCTC
TCTTCGGGCTCACTATAATGGGTATGAAGTCCGAGGACGAGGATGTCGCGAAGCTCGCTGTCGAGTTCTGGAGCACGGTT
TGCGAGGAGGAGATTGCCATTGAAGATGACAATGCACAGATTGGACCGGTACTTTCCCCCTCTCCTTGCAGGTTTTTATT
GGCAAATTTTGCATGCAATTGCTAACGTGTTGTCCAGATTGATGACCAGGACCAGCTGCGTCCTTTTTACAACTTTGCTC
GCGTTGCCACGAGCGAGGTGGTGCCAGTGCTGCTACTGCTACTCTCCAAGCAAGATGAGGATGCTGCTGATGACGAGTAC
AACATCTCACGCGCGGCATATCAGTGCTTGACCCTTTACGCACAGGCTGTGGGTCCCACCATTATCCCACACGTCATCCA
GTTTGTTGAGTCGCATTTGCGTCACGAAGACTGGCATCTACGAGATGCTGCCGTCTCTGCGTTCGGCGCGATCATGGAGG
GACCTGATGAGAAGGTGCTCGAGCCCATTGTCCAGTCTGCTCTGGCTATATTGATCTCGATGATCGATGATCCGTCGATC
CAAGTGCGTGATTCCACAGCTTTCACTTTGGGACGAATCACAGAAAATTGCTCGCAAGCCATCGACCCCGCTGTTCACCT
CGACCCTCTTATCGAAGCGCTTTTTCGCGGCCTGCTGAGCAACCCGAAGATGGCTGCCTCCTGCTGCTGGGCCCTGATGA
ACTTGGCGGAGCGCTTTGCTGGCGAGCCGGGTGCCTCTACTAACCCCCTTACTCGCCACTTCACTACCAGTGTCCGTCAT
CTATTGACCGTCACTGCACCAGATGCTGGCGCCGAGCCTGCTGTGCGCACTGCCGCATACGAGGTTCTCAACACCTTTGT
CACCAACTCCGCCCAGGACAGCCTGCAAGACATCGGCTCTCTGTCAGATGTTGTGCTTAAGCGTCTTGAAGAGACTGCCC
CACTGCAGACTCAGGTCGTTAGTGTCGAGGATAAGATCACCCTGGAAGACATGCAGACTAGTCTGTGTACTGTGTTGCAG
GCCGTTGTCGGTCGACTTGACAAGGAGATCGCTCCCCAAGGTGACCGCATCATGGCCGGTCTGCTTCAGATCCTGTCCAA
CTCTGGTGGAAAGTCGTCTGTGCCTGAGGCTGTGTTCGCCGCTATTAGCAGTTTGGCGAATGCTCTTGAGGATGACTTTG
TCAAGTACATGGATGCATTTTCACCGTACCTGTTCAAGGCCCTCGACAACCAAGAAGAGCCTAGCCTGTGCTCTATGGCC
ATCGGGCTTGTTAGCGACATCACCCGTTCCATGGGCATTCGCAGCCAGCCGTGGTGTGACAACTTCATGAACCTCTTGCT
GAACAACTTGCGCGTACGTCACAAATATTCCATTCGTGTTTGCCTAGTTCTGTGCTAATGTGTTCAGAGCACCACTTTGT
CGAACCAGTTCAAGCCAGCCATTCTGCAGTGCTTTGGCGATATTGCTGGTGCCATCGGCGGCCATTTCGAGACATATCTC
TCAGTTGTTGCCCAGGTATTGCAGCAAGCGGCCACCGTGTCGGCTGGCACTGACGGTAGCTATGAGATGTACGACTACGT
CGTCTCATTACGGGAAGGTATCATGGATGCCTGGGGCGGCATCATTGGTGCTATGACCTCTAGCCAGAAGAGTAAGCTTC
ACGGTCCTCTCCGGGTAGAAATACGGTGTGCCCTGCTAACACGCTATCTCAAGCTGCCATCCTGCAACCATATGTGCAAT
CTATCTTCCAATTGCTCAACGTTATCTCGTCTGACGGAAACCGGAGCGAGGCGCTCATGCGGTCTTCAATGGGCGTCATT
GGGTACGTTGTCTTCAGTCTGATAGCATTGACAGCTTGCGAGAAACTAACAGTGGCTACAGTGACCTTGCGAGTGCGTAT
TCGAAGGGCGAGCTTTCTGAGGCTTTCCGGCAAGACTGGGTGCTCCGCCTGATCAAGGAGACTCGCACCAACCGCGAGTA
TGCGCAACGCACGATTGATACTGCCAAGTGGGCACGCGAGCTTGTTAAGAACCAAATCGGCGGTACGACAAACGTCATTC
AGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62