GenePrediction:GLEAN_1785 Details

Name: GLEAN_1785
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1154118..1155260 (+ strand)
Length: 1143
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1154118..1154639 (+ strand)
Length: 522
Type: CDS
Source: GLEAN
Position: GCSC_144:1154703..1155260 (+ strand)
Length: 558
>GLEAN_1785 class=GenePrediction position=GCSC_144:1154118..1155260 (+ strand)
ATGATGCTGCCACCGTGCCCGCCACGGTTTGCAGCCAAGAAGGCAGCTATCCTAGCTCAACTCGCGCAGCCAGAAGGCGA
ATATGCAGATGCCTCACCCAAGGGTACCGTGGATGAGGGCGTTCGGCCATTGCTAGAAGCAATAAACAGACTAGACGGAT
TTGTCACTAGCAGCAGTTGCGCCGGGCGTGTAGCTGTCTTTATAGAGGGGCGACGAGGTGGTGTTGAGATGGACGCCCGT
GACGGCAGCGCTACATTGCCTGTGCCTTTAGCTTCTCCCCCAACAACGGTACCGGCCTCCACTGGCGGCAAGGGTGGCGG
CGGCACATGGCTGTTTGTCTCGCATAATCCACTGTTACGGGACGAGGGTCGTAACGGAAGTAATCATGGAACGCAGGGAA
GCTATGCGGACACAGATTGGGCAACGGTTTTCGGTCTGGAGGTGGGAGAAGACATCAACTCCGACTTGAGCATTGAGGAC
GAGGGCGAGCAAAGGCTGGTTCACTTGAAGTTTGAGCCTATGGTAAGCAGTTTTTTGTATCTCGATGTTGTCAACTGCAG
TATTTAACACCGGATGAAATCACAGATACTCCACGTGCTGACAGCATCACTCGCACACGCCCAGCTGCTGCTCCGCTGTG
CATTGGCGGCCGGCTTCCGCGAGAGCGGGGCTGTCAGTGTGGCCCCGAATAGCGGGGACCTAGGGACGGTTACTCTGGAT
CACGAGGCGACTATGCCCGTCGTTGCGGTGCGCTCTATGGGCCTTGGCTTGGCATCGGTGGTTGGAGTAGGCATCGAAGG
AAGTGGTCCGGCATCAGCTAGGGGACAATGCATAGTCTCTCGAGGCTATCTGGCACGTCTGGCACGTGTGACAGACCAGC
GGTTCGTCACCAACCGAGAGCGAACGGAGCGATTCCGGGTTGCCGTAGCAGCTGCCATCGAGAAAGAGCAGAATCCACAG
GCATCCTCCAGGGGCAGTGGGGGCAACAAGCCGAGCTGGGAAGATGCTGCGACACGAAAGGCACGTCTGCGCGCCGAGGG
GCTGCAGAGACAGGCGGCCCTGCAGCGGCAAATCGTGGAAAAGGCGACCGATACCCAACGAGAGGGGGCAGATGCGAACG
AAGCACTCCATCTCATCGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62