GenePrediction:GLEAN_1787 Details

Name: GLEAN_1787
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1164503..1166701 (+ strand)
Length: 2199
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1164503..1165822 (+ strand)
Length: 1320
Type: CDS
Source: GLEAN
Position: GCSC_144:1165892..1166701 (+ strand)
Length: 810
>GLEAN_1787 class=GenePrediction position=GCSC_144:1164503..1166701 (+ strand)
ATGTCATCCCAGGAGCAGGGCGCCAGTGGCGCCTTACCGACCGCCAGTAATGAGGAGCACACGTTCCCGCACTTTTCCTC
GTCCCGATCCGATGCGCCGGGGGGCGCGCCCAGCATTATTTCGTCACGCATGACAGACATGCCCGAAGAGGTCGGCGGTG
TGCCGGAAGACACGGCAACGGTCGGCGGGAGTGTGGCCGGAGACCGTTCCTCAAGACCACCGACGGCGCGAACGGGCCTG
TCTTCGGCCAGGAACTCGCAGCTGCTACATCAGAAACGGCACTCCCAACCTCTCCGTCCCGGCCTTTCCGGTAAGCGGTA
CAGCGCCAGTGGAAGCAGTGTTGTTTCCGGGTCTTCTGCATACGGCGGACGTCCTGCAAGCTCAGCGACGCGGAGTCACG
TTCCTTCTCTCACGTCACACGCTTTCTTCCACCCCATGAGCTCCCAAAAGCTGCAGGCTCAGCGTGGAGCCATCAACCGA
CCGCGTCAATCACAGCTGCTGCAGATGCAACAGGAAGGAGCTGGCGATGAGGCTGGCACGGAGACTGGTGGCAACATCAT
GTCGCATGTGCAGCAGTCAAGTTTTGCGCGACCCGTCTCCCGGGGCTCCGAGTTTACGGAGCAGGAAACGGTCGACCGTA
TCACGGCCAACACCAGCCCTACGACGGGCTATTACGCCGCGGCCTCTCTGAGCGACAGCGTGCGGCCACTCCAGCGAATC
CAGGCTGGAGCCAGCAGCGGATTTCCTGTCGAGGGCGAGGGCGGTGCCGGTCGGAGAGGCGGGCTGACGGTCAGGGTGGA
TAAGACATACAAGCCCAGCACTGTAGGCAATCCGCTGACACCTGTGCGGACGCCGCGGACGCCTCGCTCGTTCCGGTCGA
GCTTTCTGCTGGGAGCCGAGTCTGCGGGGGCAAACCGTGACATCCAAGGCGGGGAGAAGCTCGAGTCCGTGGCCTCGACG
CCACCACAGACCATGTCAGCAGCGACTTCGCAGGCACACGGCCGTGACCGGGACTGGAAGCTGGCGGCAGCCGGACGCAG
GAAGCCGCAGGATGAGGCGGAAATCACGTACGACGGCAAGAACTACCAGTACTTTGAGGGCAACACGGTGTTCTGCTTGG
GCGGACGCTTCGAAAACACAAAGTCACGGCCGTTCAACGTAGCGACCGGCACGCTGGTCGTCGTGCCCTCGATCCTCTTC
TTTGTCTTCTCGGCGTCTTGGCTGTGGCACCACGTGTCGCCAGCGATCCCCATCACGTTTGCCTACGTCTGCTACATCTG
CCTGTCATCGTTTGTGCACGCGTCCGTGACGGATCCCGGGGTAAGTGCCCGAGTGCCGTGAAGACGTCTTGTGTGTTGTT
TGCAAGGGCCCATGGCTAACAAGATGCAGATCCTGCCGCGTAACCTGCACCAATTCCCGACACCGAACGACAGCGACGAC
CCGCTGCGGCTGGGAGCACCGACGACGGACTGGGTGCTTATCAAGTCGGCAGAGTCGGCGACAGCAGCCATGGAAGTCCC
GGTCAAGTACTGCCGGACGTGCAACCTGTGGCGGCCACCGCGGGCACATCACTGCCGGGTGTGTGACAACTGCGTGGAGA
CGGCAGACCACCACTGCGTGTGGCTGAACAACTGCGTAGGCCGGCGCAACTACCGGTATTTCTTCACGTTTGTGACGTCG
TGCGCAGTGCTGGCACTATACCTGACGGCGGCGTCGCTGGTGCAGATCCTGGTGTACCGGGCACGCGAACACATTTCGTT
TGGAGCAGCCATCAGCCACTTCCGCGTGCCGTTTGCCATGGCCATCTACGGCGTGCTGGGCTGCACGTATCCGATGGTGC
TGATGGGCTACCACATGTTCCTGATGACGCGCGGCGAGACGACGCGCGAGTTTCTCAACTCGCAAAAGTTCCCCAAGAAG
GACCGCTACCGGTCCTATTCGCAGACAAGCGCGTTCTGGAACTGGGTTGCGGTGCTGTGCCGCGCGAGGACGCCGACATA
CTACCGCTTCAAGCAGCCACACATGACCGGCGACCAGCGGCTGGCGGCCGAGCCGACGAGGCAGACGGCGCGCCAGCAGC
ATCAGGCCACCGACAGCACCGGCAGCCGGGGCGACGCGGTTGAGCTGAAGCATGTACCCGTGACTGATCCTGTTGCCCCC
AGCTTCCAGGGGACAGCTTCATTGGGAGACGGGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62