GenePrediction:GLEAN_1788 Details

Name: GLEAN_1788
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1167624..1168138 (+ strand)
Length: 515
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1167624..1167674 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_144:1167743..1167907 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_144:1167972..1168028 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_144:1168085..1168138 (+ strand)
Length: 54
>GLEAN_1788 class=GenePrediction position=GCSC_144:1167624..1168138 (+ strand)
ATGTCTGTTGCACGTGCCGGCCGGCCCGAGGCATTGCAGATCCTCTCTCTGGTAAGCTGCCTCTTCGTCCAGGCTGTCCT
CGCGGTCCTGTGCTAATGTGTCTGCTCGTTGCGTTGCAGTATCGCCAGCTGCTCCGCCAGGCCGATCGCTTCCCCGAGTA
CAACTTCCGCGAGTACGCCAGGCGCCGCACCCAAGATGCCTTCCGCGAGCACCGCGCCGAGTCGGATCCGCGGCGGGTCC
AGGAGCTTGTGCAGCAGGGTCTCAAGGACCTGCGGGTCATGCAGGTGAGAGAGACGGCCCGGGTCGATGCCGTGAACCTG
TCCAGCTGACCAATTCTCTTCTCTGCAGCGGCAAAGCACGATCGGCAACTTTTACCGGTCAGAACGACTGGTCGTGGAGA
CAAGTGTACGTATGCAGCACCTGTTATGCTCCCATGTCCTCTTTCCTAACACACATCCCAGGGCCAGGCAAAGAGCCACA
ACGCGCCATTGCTGCCAGCGCGGGGATCAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62