GenePrediction:GLEAN_1791 Details

Name: GLEAN_1791
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1186858..1187519 (+ strand)
Length: 662
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1186858..1186910 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_144:1186982..1187070 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_144:1187139..1187270 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_144:1187335..1187519 (+ strand)
Length: 185
>GLEAN_1791 class=GenePrediction position=GCSC_144:1186858..1187519 (+ strand)
ATGGCCTTGCCTAAGAGGATCATCAAGGAGACGGAGCGGCTGATGGCTGAACCGTAAGAAATCAGACCTCTCGGCTCCTT
TCCACCTAACTATGCACTAACCTTGCCGCCACCCCTCTGTCCAGTGTCCCCGGCATCAGCGCCATTCCCCACTCCGACAA
CCTGCGATATTTTGACGTCGAGATCTACGGGCCGTCACAGTCTCCGTACGAGGGTTCGTTTCCCCTCTAAGTGCCGTTCT
CTCCTGGCTGTGGCCCCCGATCTGACCGGTGCCTCCTCTAGGTGGCGTCTTTAAGCTAGAGCTGTTCCTGCCGGACGACT
ACCCCATGACACCGCCAAAGATCCGTTTTCTCACCAAGCTGTACCATCCTAACGTTGACAAGCTGGGACGCATTTGTCTG
GACGTCTTGAAGAGTATGCGCGCCTGCATATTTCCATCTACATGATCTGTTCCCTCCTCGCTGACCTCTTCGTCCAGACA
ACTGGTCCCCTGCCCTGCAGATTCGCACCATCCTGCTGTCCATCCAGGCCCTTCTGGGCGCCCCCAACCCCGACGACCCA
CTGGCCCCCGATGTTGCCAAGGCCTGGAAAGACAACGAGAAGGCCGCAGTGGAAACTGCGCGTGAGTGGACACAGAAGTA
CGCGATCCCGAAGCCGCAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62