GenePrediction:GLEAN_1792 Details

Name: GLEAN_1792
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1195629..1200434 (+ strand)
Length: 4806
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1195629..1195983 (+ strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_144:1196043..1196063 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_144:1196237..1198714 (+ strand)
Length: 2478
Type: CDS
Source: GLEAN
Position: GCSC_144:1199347..1199573 (+ strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_144:1199620..1200101 (+ strand)
Length: 482
Type: CDS
Source: GLEAN
Position: GCSC_144:1200164..1200434 (+ strand)
Length: 271
>GLEAN_1792 class=GenePrediction position=GCSC_144:1195629..1200434 (+ strand)
ATGTCACTTCTCGCACCACTACGGCCACGTGGCTGGCGACGTCCCGGCTATGGCTCTCCTCTTCTCTATATCGGCCTCCT
CCTCGCACTATTCCTGGCTGTCTCTCCAACCACCGCTGCCGCCATGGGACCGGCGCATGAAACCGTGTTCATCTCGGGGG
TTGACTCCAAAGGCGTCACTCGACAACTAGCTGTCGATCGTACACCTTCGCTCTATACTAGCAGCTTCGGCGACTGCCTC
GGCGGTCAGAGCTTGTTCAACATTACCAAGTTTGATGCTGCGTATTATGCCGACAACATGACGGTGCTCTTTCATCTGGA
TGGAACCAGCAGCGTCCGCAACGAATCTCTGATGTGTGAGTCTCCAATCTTCTCCGTCAAGTGCATAAGACAAGGTTGCT
GACCCTCGTCGCAGTGGTTATCACGTTGATGGCCTGTAAGTTTTCCTTTACGCCCATTTCAAACTCTTCCCATTCTTACG
TATCTAGATGGCGCAACCCATTACATGCAGACTTTTGATCCGTGCTTTGTGAATATGGCTCAGTACGTAACCGTCTGCAT
TTTACAACAGGTGTTTTGCTGACTACCACAGTCTCTGTCCCTTGACAGCGGGCGTCCCCATCATGGGCTATGCGGTGTTC
CCTCTCACGGAAGAACAGACTGCTTCGATCCCGGAGATTGCCATGGGCATTCCCGACTTTGACAGTTATGTCAGTCTTCA
GATCTTTGCAAACTCGACCCAGTCTCTGATCGGTTGTTTCCAAGCTGCCATGACGAACGGCAATACCGTGAGCCTTCCGA
CCATCATTGCGCCCATCGTCGGGGTTATTGTCGCGGTGGCCATTGTTTCCTCTTTTATGACCGCGGCCTACGACGTTTCC
GTGCCCTTGATGCGCGCCCACTACGCCCATTCGCTGTCTGTCCTCCTTCTAGTTGAAACGCTACAGTCTATCTTCTTGAC
CGGTGCGCTTTCGCTGCATTGGCCGAGCATCCTGGTGGCCTGGTGGAGCAACTTTGCCTGGACAGTCGGCCTGGTCAACG
TGACACCTCTCATCGACAAGATCAGTGCTTTTGCAGGTGTCACAGGCAATTCTAGCCAGGTTGGCGGGGCTGGGTCGACT
TTTATCAACAACGGTGGCGGGAGGCTCGCTGGAAAGGTCTACAAGCGCGACATCATTCCAGCCCTCACTTACAACACGAC
CTCGGCCCTCTCACGCCGGAAATACTTCAACGCCAGCGACCCTTACGATTACGCCTGGGGAGGTGATCCCGTCCGTCCTG
GTGTTCCACTACCAGGCATGTGGCAGAGCTTCGCTGGCACGCTGTCTCAGTTGGGAATACCGGGAGCATCGGCCTTCACG
CTCAGTCTCTTCTGGCTGGTGATGGCCTCGCTGGCGTTCCCAGCCCTGCTCTTGGGTGTGAAGAGTCTGCTGGAGGTCCT
GGCGAAGCTGCACTGCATTCGACAAGATTCGATGGCGTACTTTCGCACCCATTACACTCGTTATGCCGTGCAGATCGGAC
TGCGAACACTGCTGCTGACCTTCTTTCCCATCATGGTGATGGCTGTGTTTCAGTTCACCCTCAGCAGCTCGCCAAAGCCG
ACAGCACTGGCGGCGGTGGTGTTTGTAGTGTACATTGTGGCAGTATCGTACCTGGTTCTCCGCATTGTCCTGGACCGACT
TCGAAGCGACCAGATGAAAGCAGCAGATAACTACGATGGTCCCACCATGGGTGCTGGGCTCTTTGCCAGGTTCACGACTA
CAAAAACTAAGGGCAACGAAGTCGTTAACCCCCAACAGCAGCAGGAGCAGAGCGGCCCATTCACCACGGGCAAAGCAAAC
ACGGAAGACCCGATACGTGTGGGTGTGCACCAGGACGAAAACTTTGTCAAGCAGTACGGCTGGTTGGTGGCACGGTTCCG
CACAAGCTGCTGGTGGTTCCCGGCCGTATATCTGTTCCTGCAGCTGATCCGTGCCTGCATACTAGGCGGAGGCGGCGCGG
ACAACAACGCAACAAACATTGACAACGTCAACGTCGGCTCGAGCGGGCCACCGACAGCCCAGGTGGTGGCACTGTGCTTA
CTGGATATCTTGATGCTGGCGCTCTATGCATATTGGCGTCCATTCGAGGGCCACCGCAACATGGCACTTGGCGTGTGGCT
GCTGTGCTCGGCACGAGCCCTGGTGACAGTACTGTGCTTTCTTCTGCTGCCGCAGGTGAAGATCAGCCGGATCGGCGCGA
CGGCGGTCGGCTTCGTGATCCTAGTGGTCCAGGTGCTGCAGCTTCTGGCTGTTCTGGCGCTGGTGGTCACAGGCGTCATC
ACGTCCTGGCTGTCGCTCAGCCGCAACGGGGACGACTTCGACTCGGAGGTGTTTGCAGGTGTGCGCCAGCGGTACCTCGA
GACCCTGCTGGCCAGTGCAACAGGAGCGCCGCGTCCGCCGCGACCGGAGACAGGACAGCGACATCGCAATGCCGAGCGCA
AGGCCCGTCGAGAGGCCGATCACCGCGCGGCATCCATGCCGCCGTCCTTTAGCGTCATCGAGGTGCGGCGAGCACCCAAG
ATCGAGGACCTGGACTTTGGCAGACCCGAAGACGGCGCAGAAGGTGACCCCAAGAAGGGCAAGAAACGTGGCCAAGATGT
TCATCACGCTCCTATGATGACCATGGCCGATGGACAGGCCGATGGCGACGAGCAAGGGGACACGCTGGGCGACCTGGGCG
ATATGGCGATACAGAAGGCCAAGCGGCGACGAGCGAACAGCGGCGGTCTTGGCGGCTTTGGCAGCAGTGGTGGCAACAAT
TCCGGCGCTGCTGGGCCGCAGATCTTTGACCCGTCTCGGGTGATTGCGAGGCACAACCGCAGCCGGACGAATAGCATGAA
TTCGCTGCACTCTGTGCACTCGACGTCCAGCAGCCTGCACCGGGCCACCCCGGGTGTCCTGGCTGGCAGCAGCAGCAACA
GTAGCGGCGCTGCAGATACGTCAGGCCCGTCCAGAAGGCCGGTATCTGCAGCATTGTTGTTTTCGGATGCGGATGTGCCG
TCAAGCGGGCGCATGATGCCGACCACTGCTGGTCCCATCGCCGATCGTATGACGCCCACAAGAGAGACTCTCCGGCGACA
TGCCTCCGAGCGACGGGCGCTGCCTCCACCGGCACCATTTCCCCCAGCACCTCTGGACTGAGGCCGGCGATGATGTTGTT
TTGCAGGCAGAAGTTCTTTTGATGTCACGTGCATCTAGAGACGAATTTCCGCTCTTTCCTTTTTGGTTGCTACGGCTGTA
AGCATGTACCGGTCTGGTGTTTTTAAGATTGTGTTTGGATTATTCTTCGTTTATGATGAATCGGCATGATGGAAACGACA
GCATAAAATTATGAGTATTACATAGTCCAGAATTAGATGGGGTCTGAACCGATGATTTAGGATCCCCCGCATTGCTGCCC
GTCTCGGCTTTTGAGGGGGAACAACGTTGTGCCCCTGCGATCTGCACCTTCCTGACCTCTTGTTCGTGTTTATATGTGTT
GAAGTGGATTCTGGCCGGCAAGCTGAATGTTTGTCAGCTCTTAGTCGTGCTTGCCTTTGTAGCAAGATATATTAACAGGC
TTGTAACTGTTGAGCCGTATATCGTATGCTCTGATACAAAGTCTTCAACCTTCAACAACTCATTCTTCTCTCGTCGTTGG
CAGCCGTTCAGCCATGTCAGGAACGCATCAATCCGCAGCTGCCAGTGGCACCCCTTCTCTGCTCGATCTCACCATCGACA
ACATCACTCCAAACACAATCCGCATCAATGACCAGACGCCCGATGCCCGCCTTCGCTACCTCATGGACCGTCTTGTCAGC
CACCTGCATGACTTTTCTCGTGAGACCCGCCTGAGCACGGACGAATGGATGGCGGCCATCTCCTTTCTCGTCGCTACCGG
CCAGATCTGCAGCGACGTGCGCAACGTATGTCTTCTCACCCCCCGATGCGTCTATTGCTCACCCGAAACAGGAATTTATT
CTTCTCTCCGATATTCTCGGCCTCTCTCTCCTCGTTGATAGCATCAACCACCCCAAGCCGGCTGGCTGCACAGAGGGATC
TGTCCTCGGACCGTTTCACACGCATGATGCTCCCACGCTGGCGAATGGCGCCTCTATGACATCCGATCCCGAGGGCGAGC
CTCTGCTGGCACTCTGCCGCATCGTCGACCCTCACGGCAGCCCCGTGCCCGGCGTCAAGGTCGACATCTGGGAGACGGAC
AGCACCGGCCACTACGACGTCCAGCATGCCGACCGTAACGAGCCGTCGGAGCGCTGCGTCATGGTCACCGGCCCCGACGG
TCGCTTCTCGTTCAAGGGAATCAAACCTGTGCCCTACCCGATTCCCCATGATGGACCGGTCGGCAAGCTGCTCCAGCGCC
TCGGCCGACACTGCTGGCGGCCGGCCCATGTCCACTTCATGTTTGAGAAGAAGGGCTGGGATCATCTGATCACGTAGGCA
TCTCCATTTCTGTTCTCCGTAAAATTGGGACCAGAACCACCTTCTAATCTGCCAGCGCACTTTATCTTCGCGGCGACCCG
TACGAGACGTCGGATGCCGTCTTCGGCGTCAAGAAGAGCCTGATTATCGATCTTGACCGGGTCGATGCAGCCACGGCCGC
CGAACACGGAGTCGCTGAAGGCTCCTGGCTGCTGAAACAAGAGTTTGTGCTCGTCACAGAGGATGAGACGGAGAACCTGC
GCGACCAAAACGCTGTCGAGTCGCTCAAGAAGCTCGGCCTACACATGAAGCTGGTGGACCACTTGCCTGTGCCTGACTTG
GATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62