GenePrediction:GLEAN_1793 Details

Name: GLEAN_1793
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1202536..1204529 (+ strand)
Length: 1994
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1202536..1202767 (+ strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_144:1202832..1204432 (+ strand)
Length: 1601
Type: CDS
Source: GLEAN
Position: GCSC_144:1204488..1204529 (+ strand)
Length: 42
>GLEAN_1793 class=GenePrediction position=GCSC_144:1202536..1204529 (+ strand)
ATGAAGACTTCGTGGAAAGATATCCCGCCAGTGCCGACAAACGCAGAGTTTGTCGACATTGTGCTGTCGTCAACACAGCG
CCGGCTTCCAACGCAAATTCGTGCGGGCTTCCAGATTGCCCGTATTCGAGCTTTCTACACACGGAAGGTCAAGTTCACGG
CCGAAGGCTTCTCGGAGAAGCTGACGTCGATCCTGACGGCCTTCCCCCGTCTCGCAGATCTGCACCCTTTCTGTACGGTC
TTTGGCTCTGCTCTCCATCCCATCGTCCGCTTGTTCTCTCGCTAACAATGGTCCAGACAGCAGTCTCTTCAACGTCCTGT
ATGATGCCGACCACTACAAGATTGCACTCTCGCACCTCTCGGGTGCCAAGAACACGATCGAGACGATCGCCCGTGACTAC
GTGCGGTTGATCAAGTATGCGCAATCGCTGTACCAGGCCAAGTCGCTAAAGCGGGCCGGCCTCGGCCGCATGTCGACGGT
GATGCGGCGGCTCAAGGACTCGCTGGCGTATCTGGAGGAGGTACGGCAGCACATTGGCCGTCTGCCGTCCATCGACCCGA
CGACCCGCACGCTGCTTGTGTTCGGCCTGCCCAACACGGGCAAGTCGAGCTTTGTGCGCAGCGTCAGCCGTACGGACACG
CCGGTCGACTCGTACGCCTTCACGACCAAGAGCCTATTCTGTGGCCACTTCGACTTTGACTACCTGCGCTTCCAGGTGAT
TGACACGCCAGGCGTGGTGGACAAGCCGCTCGAGGATATGACCACGATCGAGATGCAGTCGATCTCGGCCCTGGCTCATC
TGAACTGCGCCGTCCTCTTCTTCCTGGACCCATCCGAGCAGTGCGGCTACACGCTGGACGCGCAGTGCGCGCTCTTCAAG
AGCCTGGCGCCCATATTCTCGCAGCGGTCTGTGTACCTGGTCAGCAACAAGTCTGATCTGATGAAGCTGCAGGACCTGGA
GCCGGAAGCCCGCGCCAAGATCGAGGCGCTGGCCACGGCCTCTCACGTGGTCGACACGCTCGAGGCGTCGTGCCACACGG
GTGACGGTCTGCACAATGTCAAGGACGTGGTCTGCCGCCGGCTGATTGCCGACCGCGTGGCCAAGAAGCTCGGAGCGGTG
TCGGCCAGCGTCGACAAGGTGGGCACGCGCGGCGAGGCGTTGCTGCGGCGAATTCACGTGGCGCGACCGATGGTGGCCGG
TGGTGGTGCTAACGAGGAGGCGCTGCCGCTGCGGGAGACATTTGTGCCAGAGGCAGCCAAGGAGCGGATGCGTCCGGAGC
GGCTGGAGCGCGACCTGGAGGCCGAACAGGGCGGCCCTGGTGTGTACAACTTTGACCTGCAGCGGGACTACGTCGGGATC
GACCCGGAGCACCAGCACGACAAGATGCCGGAGGTGTACAACGGGCAGAACGTGCTCGACTTTTACAGCCCCGACATTGA
GCAGAAGATGGCCGAGCTGGAGGCTGAGGAGGAGAAGCTGATTGCCGAGGGCTACTACGACACCGAGTCGGATGACGACT
CGGAGTTTGAGGACGCCGAGGACCTGCTGGCCAAGGCGGACAAGATCCGCGAGAAGCTGGCGCTGATCCGCAACGACGCG
AAGCTGCGCAAGCGGTCGCTCAAGAACAACGCGCTCATCCCGCGCTCGATCCTGTCCAAGGCGGCCGGCCGGAAGAACCA
GCTGCGCGGCCGTGGCGGCAACAACGCGGACGAAGACGAGATGCAGGACGACGAGATGATGGACGTCGACGACGGCGCCG
TTGCCGTGCAGGCGGCCAAGATGCAGCGCGACGTCAAGACGGCCAAGCTCAAGCAGCTCGGCCAGAAGAACATGAACCGC
CACGCACGGCAGGGCGAGGCCGACCGGCATATTGCACCGTCATTGACAAAGCATCTGGTATGTTTTATTTACTTTTTTTC
CTGATTTTGTGTCCCTACTAACATCATCACAGCTGGCTGGCAAGCGTGGTATGGGCAAGACGAACCGGCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62