GenePrediction:GLEAN_1794 Details

Name: GLEAN_1794
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1214711..1217182 (+ strand)
Length: 2472
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1214711..1216414 (+ strand)
Length: 1704
Type: CDS
Source: GLEAN
Position: GCSC_144:1216556..1217182 (+ strand)
Length: 627
>GLEAN_1794 class=GenePrediction position=GCSC_144:1214711..1217182 (+ strand)
ATGGTATACAAAACGCCACCATCCGGCGGCATCGTCTGTCTGCGGTGCCAGCTGCGACTCTTGCACTCGCCACGACCTCG
CCGGCCGTCTCTCTTTCTCACCCCCCACCTTCTCTCTCGGCAGACAAGCCGCAACGGCTATGCTGCTCTTGCCAGACCCC
AGGCCTGGAAGGCGAGGGTGATCGTGGCAAGCCCAAGACGCTTGCACCATGCAGCCTCTAAGGATGTCGACAGCAAGGCC
GCAGTGCAGCCAAAATTCTCCAGGGACGACGAAACACCGGTCCTGCTGCCAGACTCCAGCGAGCCGCCTGCCAAGTCAGA
CGAGGCGGCAGCCAAGTCCGACATGGAGGACATATGGGACTCCCTGCTGGCGGACGGTATCAAGGCGACGTCGGACGAGG
TGTCCAGCCACATTGACGCGCTGCGGCCGACAGACGAGACCACCGTGACCCGCTCCGACTTCCAGCGCCGAAGGGAGAGC
CTGACGGCCGGCTTCACCGTCGCACAGCTGCGCGAGTACATTGACGCACACCGCGAGCCGGTTGTCCGGCCAGCCGCCTA
CGCCTGGGCAGTGCAGCAGCTGCCGTGGGTTCCGGGCGGGCCAGCCAGCGAGCTGAAGGCCAAGACGCCCTCCTCGGCTC
TTTTCCTGCGCGGCTACACCACGTCGTCGATGCTGAGCAAGGATTGGCTGGCCGTGCAGCTGATGCGCGAGTGCTGGGGC
CTCGCCGTGCGCGAGTTGATGGACGCTCCCGGACTGCTGGACGTCACCGTGCGCGAGCTTGAGTTTGCCCTCCTGGCTGC
CGGTGCCCAGTCGTGGCTGCGCGACATCTCGACTGCCTACTCGACCGTCACGACGACGACTGCTGCCACCGGTCGCAGCC
GCAGTCGCAGCCACAGTCGTGGCCAAACTCGCCAGCACCGCCACATTGAGCTAGACCCCGGCCAGCGCCTGCTGCGCATC
TCCGCCCCCGCCGTCACGGCCGACGCCATCCTGGCCGACATTGACTGCATGCTGGCCCGCGCCACCACGCGCGCCTTTCG
CCTGGCTGACGTGGCAGACACGCGTGTTGTCGGTGCTCTTGATGCTCACATGCTGAGGGCCGTCGGTGCCATGACTGAGA
GCTGGGTGCGGCTGAGTGCGGATGAGGACGAAGTACTGGTCAGCTGGATCGCCCAAGACCATGACCACGACCACCATCTC
GAAGATACCGGAGACAGGGTACACCGGTTTCTGCTCACAGCTTTTGGCACCTCCACCCTGCCCCAGACGACCGAGCTGGA
CTACGAACCCCTCAAGCGCACAAAAGCTCGCCTGCTCGCCGAGTTCGATAGCTTCAGCCGTGACACCTGGTCCTGGCCCT
ATCGCCACCGCAACTGGGCCCGTCTGGTCGAACCCTTTCTGGCCGACGCATCGGCTGCGCGCACTCGGCTGCCCGTCCAG
CTGCCCGGCGCCCACTCGATGCCCTTTGAGTTTGTCTCCCCCCATACGGCCACGGCCACGACCGATACAGGCGCAAATGC
AGGCGCAGATGCAGACGCCGAAGACGACCACAGCCAAAGGTGGTATCGTCTCATCCGCACTTCCACCGTCGCTACCTTCG
GTCGCGTCCTCCACAGCCCGCCGTCCGCAGACAAGACCAGCACCCTGTCTGACATGGCCAGTCCGGCCACTGCGCTTCAA
GGCCTGGAACGGATCTTGACTCCGGTAGCGCCGCCTCTGCTGGGACTCAATCTGGCCGATGAGCCGCTGATTGACACCAC
CACCACCACCACTACGACCACGCTCCTGCTGCTCTTCCAGCCGCAGCCCAACACAGCCCTAGCTGACTGTGCCCCCCCTC
TGGAGGTCTACCTGGACATCTCAGACGGCCGGCCGGTCCTGGCCGCCCTGCACACGGTCATGGCCGCCCACACGAGCGAC
GTGCTCTTCCCGACACAGCCTGTGGACGTGCGCATCACGCAGAAGCGCTTCTTTGCGCTGCCGGCCGCCGACATCGCCGC
CGATCCGGCCCTCGACCCGCTACGCGCCTTTCTCGCACAGGCACGGCTGGGCCAGCTGGGCCCGTCTGGCCAGCCGCTGC
CGCTATCGACACCGGCACGGCTGTCCGGCCTCGGCCTGCCGGCACGCGTGCTGCTTCCGGTCGGCGACGGGGCCAGGCTG
CGCGAACAGCCGCGCAGGCGCCACCAGACCATCGCCGTCGACTACGTCTTTGCCGGGCTCGAGGTGCGCCGCCGCGTCGC
CACCGCCTTTGAGGGCTGGACGCTCGCCCTGACCAGCGTCGACGCCGGGCGTGGTGGCGGCCGCCACACAGCCCTCACAC
TGGACGCAACGCCTGCGGGGACGGAGTCTGGGGTGTCCGGGGTCACTCTCGCCACTGGCGGGGACCTCAGCAAGACGGCC
TTTCGCCATGCCGTCGGCCGGCTCGTCCACAGCGACACAATCCACTGGCTGATACCGGGTCGGGAGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62